Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens microRNA mir-214 URS0000714B17_9606

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUGUCAUUCAGGCUGGGUUGUCAUGUGACUGCCUGUCUGUGCCUGCUGUACAGGUGAGCGGAUGUUCUGCACAGCAAGUGUAGACAGGCAGACACAUGACAACUCUGUCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 0 other species

  1. Callithrix jacchus (white-tufted-ear marmoset) microRNA mir-214
  2. Cavia porcellus (Domestic guinea pig) microRNA mir-214
  3. Chlorocebus sabaeus microRNA mir-214
  4. Cricetulus griseus microRNA mir-214
  5. Fukomys damarensis microRNA mir-214
  6. Gorilla gorilla gorilla (western lowland gorilla) microRNA mir-214
  7. Macaca mulatta microRNA mir-214
  8. Mesocricetus auratus microRNA mir-214
  9. Neotoma lepida (desert woodrat) microRNA mir-214
  10. Nomascus leucogenys microRNA mir-214
  11. Otolemur garnettii microRNA mir-214
  12. Pan troglodytes (chimpanzee) microRNA mir-214
  13. Papio anubis (Olive baboon) microRNA mir-214
  14. Pongo abelii microRNA mir-214
Publications