Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Nomascus leucogenys tRNA-Thr (AGT) (tRNA-Thr-AGT-2-1) secondary structure diagram

Nomascus leucogenys tRNA-Thr (AGT) (tRNA-Thr-AGT-2-1) URS00006B0F93_61853

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGCCCUGUGGCUUAGCUGGUCAAAGCGCCUGUCUAGUAAACAGGAGAUCCUGGGUUCGAAUCCCAGCGGGGCCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 32 other species

  1. Balaenoptera acutorostrata scammoni tRNA-Thr (AGT) (tRNA-Thr-AGT-6-1)
  2. Bos taurus tRNA-Thr (AGT) (tRNA-Thr-AGT-6-1)
  3. Callithrix jacchus tRNA-Thr (AGT) (tRNA-Thr-AGT-3-1)
  4. Camelus ferus tRNA
  5. Carlito syrichta tRNA-Thr (AGT) (tRNA-Thr-AGT-6-1)
  6. Chlorocebus sabaeus tRNA-Thr (AGT) (tRNA-Thr-AGT-3-1)
  7. Dipodomys ordii tRNA-Thr (AGT) (tRNA-Thr-AGT-7-1)
  8. Eptesicus nilssonii tRNA-Thr
  9. Equus caballus tRNA-Thr (AGT) (tRNA-Thr-AGT-7-1)
  10. Homo sapiens tRNA-Thr (anticodon AGT) 6-1 (TRT-AGT6-1)
  11. Ictidomys tridecemlineatus tRNA-Thr (AGT) (tRNA-Thr-AGT-5-1)
  12. Loxodonta africana tRNA-Thr (AGT) (tRNA-Thr-AGT-9-1)
  13. Macaca mulatta tRNA-Thr (AGT) (tRNA-Thr-AGT-2-1)
  14. Marmota monax (woodchuck) tRNA.Thr
  15. Microcebus murinus tRNA-Thr (AGT) (tRNA-Thr-AGT-5-1)
  16. Myotis brandtii tRNA
  17. Myotis davidii tRNA
  18. Myotis lucifugus tRNA-Thr (AGT) (tRNA-Thr-AGT-3-1)
  19. Ochotona princeps tRNA-Thr (AGT) (tRNA-Thr-AGT-6-1)
  20. Otolemur garnettii tRNA-Thr (AGT) (tRNA-Thr-AGT-6-1)
  21. Ovis aries tRNA-Thr (AGT) (tRNA-Thr-AGT-6-1)
  22. Pan troglodytes tRNA-Thr (AGT) (tRNA-Thr-AGT-3-1)
  23. Papio anubis tRNA-Thr (AGT) (tRNA-Thr-AGT-2-1)
  24. Pongo abelii (Sumatran orangutan) tRNA
  25. Procavia capensis tRNA-Thr (AGT) (tRNA-Thr-AGT-5-1)
  26. Pteropus alecto (black flying fox) tRNA
  27. Saimiri boliviensis boliviensis tRNA-Thr (AGT) (tRNA-Thr-AGT-3-1)
  28. Sus scrofa tRNA-Thr (AGT) (tRNA-Thr-AGT-4-1)
  29. Trichechus manatus latirostris tRNA-Thr (AGT) (tRNA-Thr-AGT-8-1)
  30. Tupaia chinensis tRNA
  31. Tursiops truncatus tRNA-Thr (AGT) (tRNA-Thr-AGT-5-1)
  32. Vicugna pacos tRNA-Thr (AGT) (tRNA-Thr-AGT-6-1)
2D structure Publications