v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Vicugna pacos tRNA-Thr (AGT) (tRNA-Thr-AGT-6-1) secondary structure diagram

Vicugna pacos tRNA-Thr (AGT) (tRNA-Thr-AGT-6-1) URS00006B0F93_30538

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GGCCCUGUGGCUUAGCUGGUCAAAGCGCCUGUCUAGUAAACAGGAGAUCCUGGGUUCGAAUCCCAGCGGGGCCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 32 other species

  1. Balaenoptera acutorostrata scammoni tRNA-Thr (AGT) (tRNA-Thr-AGT-6-1)
  2. Bos taurus tRNA-Thr (AGT) (tRNA-Thr-AGT-6-1)
  3. Callithrix jacchus tRNA-Thr (AGT) (tRNA-Thr-AGT-3-1)
  4. Camelus ferus tRNA
  5. Carlito syrichta tRNA-Thr (AGT) (tRNA-Thr-AGT-6-1)
  6. Chlorocebus sabaeus tRNA-Thr (AGT) (tRNA-Thr-AGT-3-1)
  7. Dipodomys ordii tRNA-Thr (AGT) (tRNA-Thr-AGT-7-1)
  8. Eptesicus nilssonii tRNA-Thr
  9. Equus caballus tRNA-Thr (AGT) (tRNA-Thr-AGT-7-1)
  10. Homo sapiens tRNA-Thr (anticodon AGT) 6-1 (TRT-AGT6-1)
  11. Ictidomys tridecemlineatus tRNA-Thr (AGT) (tRNA-Thr-AGT-5-1)
  12. Loxodonta africana tRNA-Thr (AGT) (tRNA-Thr-AGT-9-1)
  13. Macaca mulatta tRNA-Thr (AGT) (tRNA-Thr-AGT-2-1)
  14. Marmota monax (woodchuck) tRNA.Thr
  15. Microcebus murinus tRNA-Thr (AGT) (tRNA-Thr-AGT-5-1)
  16. Myotis brandtii tRNA
  17. Myotis davidii tRNA
  18. Myotis lucifugus tRNA-Thr (AGT) (tRNA-Thr-AGT-3-1)
  19. Nomascus leucogenys tRNA-Thr (AGT) (tRNA-Thr-AGT-2-1)
  20. Ochotona princeps tRNA-Thr (AGT) (tRNA-Thr-AGT-6-1)
  21. Otolemur garnettii tRNA-Thr (AGT) (tRNA-Thr-AGT-6-1)
  22. Ovis aries tRNA-Thr (AGT) (tRNA-Thr-AGT-6-1)
  23. Pan troglodytes tRNA-Thr (AGT) (tRNA-Thr-AGT-3-1)
  24. Papio anubis tRNA-Thr (AGT) (tRNA-Thr-AGT-2-1)
  25. Pongo abelii (Sumatran orangutan) tRNA
  26. Procavia capensis tRNA-Thr (AGT) (tRNA-Thr-AGT-5-1)
  27. Pteropus alecto (black flying fox) tRNA
  28. Saimiri boliviensis boliviensis tRNA-Thr (AGT) (tRNA-Thr-AGT-3-1)
  29. Sus scrofa tRNA-Thr (AGT) (tRNA-Thr-AGT-4-1)
  30. Trichechus manatus latirostris tRNA-Thr (AGT) (tRNA-Thr-AGT-8-1)
  31. Tupaia chinensis tRNA
  32. Tursiops truncatus tRNA-Thr (AGT) (tRNA-Thr-AGT-5-1)
 2D structure