v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Loxodonta africana tRNA-Arg (TCG) (tRNA-Arg-TCG-4-1, tRNA-Arg-TCG-4-2) secondary structure diagram

Loxodonta africana tRNA-Arg (TCG) (tRNA-Arg-TCG-4-1, tRNA-Arg-TCG-4-2) URS0000677EA0_9785

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GACCACGUGGCCUAAUGGAUAAGGCGUCUGACUUCGGAUCAGAAGAUUGAGGGUUCGAAUCCCUUCGUGGUUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

  1. Chlorocebus sabaeus tRNA-Arg (TCG) (tRNA-Arg-TCG-5-1)
  2. Cricetulus griseus tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1)
  3. Erinaceus europaeus tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1)
  4. Homo sapiens tRNA-Arg (anticodon TCG) 4-1 (TRR-TCG4-1)
  5. Macaca mulatta tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1)
  6. Mesocricetus auratus tRNA
  7. Microcebus murinus tRNA-Arg (TCG) (tRNA-Arg-TCG-5-1)
  8. Ornithorhynchus anatinus tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1)
  9. Pan troglodytes tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1)
  10. Papio anubis tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1)
  11. Pongo abelii tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1)
  12. Procavia capensis tRNA-Arg (TCG) (tRNA-Arg-TCG-5-1, tRNA-Arg-TCG-5-2)
  13. Rattus norvegicus tRNA-Arg (TCG) (tRNA-Arg-TCG-4-1)
 2D structure Publications