Papio anubis tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Papio anubis tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1) URS0000677EA0_9555

73 nucleotides
2 databases (GtRNAdb, Rfam)
Found in 13 other species
56 publications
1. sncRNA
2. tRNA
3. arginyl tRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

GACCACGUGGCCUAAUGGAUAAGGCGUCUGACUUCGGAUCAGAAGAUUGAGGGUUCGAAUCCCUUCGUGGUUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

Chlorocebus sabaeus tRNA-Arg (TCG) (tRNA-Arg-TCG-5-1)
Cricetulus griseus tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1)
Erinaceus europaeus tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1)
Homo sapiens tRNA-Arg (anticodon TCG) 4-1 (TRR-TCG4-1)
Loxodonta africana tRNA-Arg (TCG) (tRNA-Arg-TCG-4-1, tRNA-Arg-TCG-4-2)
Macaca mulatta tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1)
Mesocricetus auratus tRNA
Microcebus murinus tRNA-Arg (TCG) (tRNA-Arg-TCG-5-1)
Ornithorhynchus anatinus tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1)
Pan troglodytes tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1)
Pongo abelii tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1)
Procavia capensis tRNA-Arg (TCG) (tRNA-Arg-TCG-5-1, tRNA-Arg-TCG-5-2)
Rattus norvegicus tRNA-Arg (TCG) (tRNA-Arg-TCG-4-1)

2D structure

Publications