Pongo abelii (Sumatran orangutan) snoRNA (ENSPPYG00000024148.2)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pongo abelii (Sumatran orangutan) snoRNA (ENSPPYG00000024148.2) URS0000676D30_9601

75 nucleotides
3 databases (ENA, Ensembl, Rfam)
Found in 5 other species
61 publications

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

UGGACCAAUGAUGACAAAUACCGGCGUAUGAGUCUUGGAUGAUGAAUAAUACGUGUCUGGAACUCUGAGGUCCAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 5 other species

Gorilla gorilla gorilla (Western Lowland Gorilla) small nucleolar RNA, C/D box 114-12 (ENSGGOG00000031968.2)
Homo sapiens small nucleolar RNA, C/D box 114-12 (SNORD114-12)
Nomascus leucogenys small nucleolar RNA, C/D box 114-12 (ENSNLEG00000023129.2)
Pan paniscus (bonobo) small nucleolar RNA, C/D box 114-12 (ENSPPAG00000001995.1)
Pan troglodytes small nucleolar RNA, C/D box 114-12 (ENSPTRG00000026456.2)

2D structure

Publications