Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Xenopus tropicalis tRNA-Arg (TCG) (tRNA-Arg-TCG-4 1 to 34) secondary structure diagram

Xenopus tropicalis tRNA-Arg (TCG) (tRNA-Arg-TCG-4 1 to 34) URS000066103F_8364

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GACCGCGUGGCCUAAUGGAUAAGGCGUCUGACUUCGGAUCAGAAGAUUGAGGGUUCGAGUCCCUUCGUGGUCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 104 other species

  1. Albula glossodonta (roundjaw bonefish) tRNA-OTHER
  2. Albula goreensis tRNA-Arg
  3. Alligator mississippiensis tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1, tRNA-Arg-TCG-2-2)
  4. Alligator sinensis (Chinese alligator) tRNA
  5. Alosa alosa tRNA-Arg
  6. Amazona aestiva tRNA
  7. Ameiurus melas tRNA-Arg
  8. Anas platyrhynchos tRNA
  9. Anguilla anguilla tRNA-Arg
  10. Anolis carolinensis tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1)
  11. Astyanax mexicanus tRNA
  12. Ataeniobius toweri tRNA-Arg
  13. Callipepla squamata tRNA
  14. Callithrix jacchus tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1)
  15. Calypte anna tRNA
  16. Carlito syrichta tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1)
  17. Cavia porcellus tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1)
  18. Ceratotherium simum simum tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1)
  19. Characodon lateralis tRNA-Arg
  20. Chelonia mydas tRNA
  21. Chelydra serpentina (Common snapping turtle) tRNA-Arg
  22. Chlorocebus sabaeus tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1)
  23. Chrysemys picta bellii tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1, tRNA-Arg-TCG-2-2)
  24. Colinus virginianus tRNA
  25. Columba livia tRNA
  26. Crenichthys baileyi tRNA-Arg
  27. Cricetulus griseus tRNA
  28. Danionella translucida tRNA-Arg
  29. Danio rerio tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1)
  30. Dipodomys ordii tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1)
  31. Echinops telfairi tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1)
  32. Equus caballus tRNA-Arg (TCG) (tRNA-Arg-TCG-1-1)
  33. Erinaceus europaeus tRNA-Arg (TCG) (tRNA-Arg-TCG-1-1)
  34. Exaiptasia diaphana (Sea anemone) tRNA-Arg
  35. Felis catus tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1)
  36. Fukomys damarensis tRNA
  37. Fulmarus glacialis (northern fulmar) tRNA
  38. Gadus morhua tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1)
  39. Gallus gallus tRNA-Arg (TCG) (tRNA-Arg-TCG-1-1)
  40. Gasterosteus aculeatus (three-spined stickleback) tRNA
  41. Gorilla gorilla gorilla tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1)
  42. Heterocephalus glaber tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1)
  43. Hippoglossus stenolepis tRNA-Arg
  44. Homo sapiens tRNA-Arg (anticodon TCG) 3-1 (TRR-TCG3-1)
  45. Ictidomys tridecemlineatus tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1)
  46. Lamprotornis superbus tRNA-OTHER
  47. Larimichthys crocea tRNA
  48. Latimeria chalumnae tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1)
  49. Lepisosteus oculatus tRNA
  50. Loxodonta africana tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1)
  51. Macaca mulatta tRNA-Arg (TCG) (tRNA-Arg-TCG-4-1)
  52. Marmota monax tRNA.Arg
  53. Megalops atlanticus (tarpon) tRNA-Arg
  54. Melopsittacus undulatus tRNA-Arg (TCG) (tRNA-Arg-TCG-1-1)
  55. Merluccius polli tRNA-Arg
  56. Microcebus murinus tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1)
  57. Monodelphis domestica tRNA-Arg (TCG) (tRNA-Arg-TCG-1-1, tRNA-Arg-TCG-1-2)
  58. Mus caroli tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1)
  59. Mus musculus castaneus tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1)
  60. Mus musculus domesticus tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1)
  61. Mus musculus musculus tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1)
  62. Mus musculus tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1)
  63. Mus pahari tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1)
  64. Mus spretus tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1)
  65. Mustela putorius furo tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1)
  66. Nematostella vectensis tRNA-Arg for anticodon UCG
  67. Neotoma lepida tRNA
  68. Nipponia nippon (crested ibis) tRNA
  69. Nomascus leucogenys tRNA-Arg (TCG) (tRNA-Arg-TCG-4-1)
  70. Nothobranchius furzeri tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1)
  71. Ophiophagus hannah tRNA
  72. Oreochromis niloticus tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1)
  73. Ornithorhynchus anatinus tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1)
  74. Oryzias latipes tRNA-Arg (TCG) (tRNA-Arg-TCG-1-1)
  75. Otolemur garnettii tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1)
  76. Pangasianodon gigas (Mekong giant catfish) tRNA-Arg
  77. Pangasianodon hypophthalmus tRNA-Arg
  78. Pangasius djambal tRNA-Arg
  79. Pan troglodytes tRNA-Arg (TCG) (tRNA-Arg-TCG-4-1)
  80. Papio anubis tRNA-Arg (TCG) (tRNA-Arg-TCG-4-1)
  81. Patagioenas fasciata monilis tRNA
  82. Pelobates cultripes (western spadefoot toad) tRNA.Arg
  83. Pelodiscus sinensis tRNA
  84. Perca flavescens tRNA-Arg
  85. Perca fluviatilis tRNA-Arg
  86. Dryobates pubescens tRNA
  87. Pleuronectes platessa tRNA-Arg
  88. Podarcis lilfordi tRNA.Arg
  89. Poecilia formosa tRNA
  90. Pongo abelii tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1)
  91. Priapulus caudatus tRNA-Arg
  92. Procavia capensis tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1)
  93. Rattus norvegicus tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1)
  94. Saimiri boliviensis boliviensis tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1)
  95. Sarcophilus harrisii tRNA-Arg (TCG) (tRNA-Arg-TCG-1-1, tRNA-Arg-TCG-1-2)
  96. Scleropages formosus (Asian bonytongue) tRNA
  97. Sorex araneus tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1)
  98. Sphaerodactylus townsendi tRNA-Arg
  99. Struthio camelus australis tRNA
  100. Taeniopygia guttata tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1)
  101. Takifugu rubripes tRNA-Arg (TCG) (tRNA-Arg-TCG-4-1)
  102. Tetraodon nigroviridis tRNA
  103. Trichechus manatus latirostris tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1)
  104. Xenopus laevis tRNA
2D structure