Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Carlito syrichta tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1) secondary structure diagram

Carlito syrichta tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1) URS000066103F_1868482

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GACCGCGUGGCCUAAUGGAUAAGGCGUCUGACUUCGGAUCAGAAGAUUGAGGGUUCGAGUCCCUUCGUGGUCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 104 other species

  1. Albula glossodonta (roundjaw bonefish) tRNA-OTHER
  2. Albula goreensis tRNA-Arg
  3. Alligator mississippiensis tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1, tRNA-Arg-TCG-2-2)
  4. Alligator sinensis (Chinese alligator) tRNA
  5. Alosa alosa tRNA-Arg
  6. Amazona aestiva tRNA
  7. Ameiurus melas tRNA-Arg
  8. Anas platyrhynchos tRNA
  9. Anguilla anguilla tRNA-Arg
  10. Anolis carolinensis tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1)
  11. Astyanax mexicanus tRNA
  12. Ataeniobius toweri tRNA-Arg
  13. Callipepla squamata tRNA
  14. Callithrix jacchus tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1)
  15. Calypte anna tRNA
  16. Cavia porcellus tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1)
  17. Ceratotherium simum simum tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1)
  18. Characodon lateralis tRNA-Arg
  19. Chelonia mydas tRNA
  20. Chelydra serpentina (Common snapping turtle) tRNA-Arg
  21. Chlorocebus sabaeus tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1)
  22. Chrysemys picta bellii tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1, tRNA-Arg-TCG-2-2)
  23. Colinus virginianus tRNA
  24. Columba livia tRNA
  25. Crenichthys baileyi tRNA-Arg
  26. Cricetulus griseus tRNA
  27. Danionella translucida tRNA-Arg
  28. Danio rerio tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1)
  29. Dipodomys ordii tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1)
  30. Echinops telfairi tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1)
  31. Equus caballus tRNA-Arg (TCG) (tRNA-Arg-TCG-1-1)
  32. Erinaceus europaeus tRNA-Arg (TCG) (tRNA-Arg-TCG-1-1)
  33. Exaiptasia diaphana (Sea anemone) tRNA-Arg
  34. Felis catus tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1)
  35. Fukomys damarensis tRNA
  36. Fulmarus glacialis (northern fulmar) tRNA
  37. Gadus morhua tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1)
  38. Gallus gallus tRNA-Arg (TCG) (tRNA-Arg-TCG-1-1)
  39. Gasterosteus aculeatus (three-spined stickleback) tRNA
  40. Gorilla gorilla gorilla tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1)
  41. Heterocephalus glaber tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1)
  42. Hippoglossus stenolepis tRNA-Arg
  43. Homo sapiens tRNA-Arg (anticodon TCG) 3-1 (TRR-TCG3-1)
  44. Ictidomys tridecemlineatus tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1)
  45. Lamprotornis superbus tRNA-OTHER
  46. Larimichthys crocea tRNA
  47. Latimeria chalumnae tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1)
  48. Lepisosteus oculatus tRNA
  49. Loxodonta africana tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1)
  50. Macaca mulatta tRNA-Arg (TCG) (tRNA-Arg-TCG-4-1)
  51. Marmota monax tRNA.Arg
  52. Megalops atlanticus (tarpon) tRNA-Arg
  53. Melopsittacus undulatus tRNA-Arg (TCG) (tRNA-Arg-TCG-1-1)
  54. Merluccius polli tRNA-Arg
  55. Microcebus murinus tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1)
  56. Monodelphis domestica tRNA-Arg (TCG) (tRNA-Arg-TCG-1-1, tRNA-Arg-TCG-1-2)
  57. Mus caroli tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1)
  58. Mus musculus castaneus tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1)
  59. Mus musculus domesticus tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1)
  60. Mus musculus musculus tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1)
  61. Mus musculus tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1)
  62. Mus pahari tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1)
  63. Mus spretus tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1)
  64. Mustela putorius furo tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1)
  65. Nematostella vectensis tRNA-Arg for anticodon UCG
  66. Neotoma lepida tRNA
  67. Nipponia nippon (crested ibis) tRNA
  68. Nomascus leucogenys tRNA-Arg (TCG) (tRNA-Arg-TCG-4-1)
  69. Nothobranchius furzeri tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1)
  70. Ophiophagus hannah tRNA
  71. Oreochromis niloticus tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1)
  72. Ornithorhynchus anatinus tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1)
  73. Oryzias latipes tRNA-Arg (TCG) (tRNA-Arg-TCG-1-1)
  74. Otolemur garnettii tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1)
  75. Pangasianodon gigas (Mekong giant catfish) tRNA-Arg
  76. Pangasianodon hypophthalmus tRNA-Arg
  77. Pangasius djambal tRNA-Arg
  78. Pan troglodytes tRNA-Arg (TCG) (tRNA-Arg-TCG-4-1)
  79. Papio anubis tRNA-Arg (TCG) (tRNA-Arg-TCG-4-1)
  80. Patagioenas fasciata monilis tRNA
  81. Pelobates cultripes (western spadefoot toad) tRNA.Arg
  82. Pelodiscus sinensis tRNA
  83. Perca flavescens tRNA-Arg
  84. Perca fluviatilis tRNA-Arg
  85. Dryobates pubescens tRNA
  86. Pleuronectes platessa tRNA-Arg
  87. Podarcis lilfordi tRNA.Arg
  88. Poecilia formosa tRNA
  89. Pongo abelii tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1)
  90. Priapulus caudatus tRNA-Arg
  91. Procavia capensis tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1)
  92. Rattus norvegicus tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1)
  93. Saimiri boliviensis boliviensis tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1)
  94. Sarcophilus harrisii tRNA-Arg (TCG) (tRNA-Arg-TCG-1-1, tRNA-Arg-TCG-1-2)
  95. Scleropages formosus (Asian bonytongue) tRNA
  96. Sorex araneus tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1)
  97. Sphaerodactylus townsendi tRNA-Arg
  98. Struthio camelus australis tRNA
  99. Taeniopygia guttata tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1)
  100. Takifugu rubripes tRNA-Arg (TCG) (tRNA-Arg-TCG-4-1)
  101. Tetraodon nigroviridis tRNA
  102. Trichechus manatus latirostris tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1)
  103. Xenopus laevis tRNA
  104. Xenopus tropicalis tRNA-Arg (TCG) (tRNA-Arg-TCG-4 1 to 34)
2D structure