v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Nomascus leucogenys (Northern white-cheeked gibbon) tRNA secondary structure diagram

Nomascus leucogenys (Northern white-cheeked gibbon) tRNA URS0000640695_61853

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GGCUCCGUGGCGCAAUGGAUAGCGCAUUGGACUUCUAGAGGCUGAAGGCAUUCAAAGGUUCCGGGUUCGAGUCCCGGCGGAGUCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 23 other species

  1. Callithrix jacchus (white-tufted-ear marmoset) tRNA
  2. Camelus ferus tRNA
  3. Cavia porcellus (Domestic guinea pig) tRNA
  4. Cervus elaphus hippelaphus tRNA-Arg
  5. Chlorocebus sabaeus tRNA
  6. Dipodomys ordii (Ord's kangaroo rat) tRNA
  7. Equus caballus tRNA
  8. Erinaceus europaeus tRNA
  9. Felis catus (domestic cat) tRNA
  10. Gorilla gorilla gorilla (western lowland gorilla) tRNA
  11. Homo sapiens tRNA
  12. Loxodonta africana tRNA
  13. Macaca mulatta tRNA
  14. Mus musculus (house mouse) tRNA
  15. Oryctolagus cuniculus (rabbit) tRNA
  16. Otolemur garnettii tRNA
  17. Pan troglodytes (chimpanzee) tRNA
  18. Papio anubis tRNA
  19. Pongo abelii tRNA
  20. Pteropus alecto tRNA
  21. Rattus norvegicus tRNA
  22. Ictidomys tridecemlineatus tRNA
  23. Tupaia chinensis (Chinese tree shrew) tRNA
 2D structure Publications