Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Cavia porcellus (Domestic guinea pig) tRNA secondary structure diagram

Cavia porcellus (Domestic guinea pig) tRNA URS0000640695_10141

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGCUCCGUGGCGCAAUGGAUAGCGCAUUGGACUUCUAGAGGCUGAAGGCAUUCAAAGGUUCCGGGUUCGAGUCCCGGCGGAGUCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 23 other species

  1. Callithrix jacchus (white-tufted-ear marmoset) tRNA
  2. Camelus ferus tRNA
  3. Cervus elaphus hippelaphus tRNA-Arg
  4. Chlorocebus sabaeus tRNA
  5. Dipodomys ordii (Ord's kangaroo rat) tRNA
  6. Equus caballus tRNA
  7. Erinaceus europaeus tRNA
  8. Felis catus (domestic cat) tRNA
  9. Gorilla gorilla gorilla (western lowland gorilla) tRNA
  10. Homo sapiens tRNA
  11. Loxodonta africana tRNA
  12. Macaca mulatta tRNA
  13. Mus musculus (house mouse) tRNA
  14. Nomascus leucogenys tRNA
  15. Oryctolagus cuniculus (rabbit) tRNA
  16. Otolemur garnettii tRNA
  17. Pan troglodytes (chimpanzee) tRNA
  18. Papio anubis tRNA
  19. Pongo abelii tRNA
  20. Pteropus alecto tRNA
  21. Rattus norvegicus tRNA
  22. Ictidomys tridecemlineatus tRNA
  23. Tupaia chinensis (Chinese tree shrew) tRNA
2D structure Publications