Homo sapiens (human) small nucleolar RNA, C/D box 89 (SNORD89)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) small nucleolar RNA, C/D box 89 (SNORD89) URS0000633321_9606

114 nucleotides
9 databases (ENA, Ensembl, GeneCards, HGNC, MalaCards, RefSeq, Rfam, snoDB, snOPY)
Found in 2 other species
47 publications

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD89: SNORD89, a small nucleolar RNA (snoRNA), has been implicated in the regulation of the Notch pathway in ovarian cancer [PMC6686521]. In a study using Ishikawa cells, plasmids overexpressing SNORD89 were transfected, suggesting a potential role of SNORD89 in ovarian cancer [PMC9256700]. Additionally, Kaplan-Meier analysis identified SNORD89 as one of four snoRNAs associated with poor prognosis in ovarian cancer [PMC6686521]. The expression of SNORD89 was further confirmed in clinical samples [PMC9256700]. In the context of endometrial cancer, analysis from the TCGA database revealed significantly increased expression of SNORD89 in endometrial cancer tissues compared to normal endometrial tissues [PMC9256700].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

ACUGAGGAAUGAUGACAAGAAAAGGCCGAAUUGCAGUGUCUCCAUCAGCAGUUUGCUCUCCAUGGGCACACGAUGACAAAAUAUCCUGAAGCGAACCACUAGUCUGACCUCAGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.