Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 69 (SNORD69) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 69 (SNORD69) URS00006292A1_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

snord69: SNORD69 is a small nucleolar RNA (snoRNA) of the C/D box class, which is primarily characterized by its role in guiding the 2′-O-methylation of ribosomal RNA (rRNA) [PMC8188706]. This snoRNA was identified in multiple studies, suggesting its prevalence and potential importance in various biological processes [PMC9393553]. SNORD69 was found to be one of the most abundant snoRNAs in extracellular vesicles (EVs) and was significantly present in plasma, indicating its potential as a biomarker for age-related changes [PMC9136061; PMC6052399]. It has been detected consistently across different sample types, highlighting its stability and ubiquity [PMC8188706]. SNORD69 has also been associated with major psychiatric mood disorders when found in a genomic region linked to glucose and lipid abnormalities [PMC4382905]. Comparative studies across species have shown that SNORD69 has conserved functions but also species-specific roles, as seen with its dual-guide modification activities identified in Xenopus and fish [PMC6984369]. The expression of SNORD69 has been validated through northern blot analysis, confirming its presence across different cell types [PMC6984369].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAUGUGAAGCAAAUGAUGAUAAACUGGAUCUGACUGACUGUGCUGAGUCUGUUCAAUCCAACCCUGAGCUUCAUGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

Relationships

Molecular Relationships

2D structure

Loading 2D structure...

Expression Publications