v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saimiri boliviensis boliviensis (Bolivian squirrel monkey) small nucleolar RNA, C/D box 69 (ENSSBOG00000006927.1) secondary structure diagram

Saimiri boliviensis boliviensis (Bolivian squirrel monkey) small nucleolar RNA, C/D box 69 (ENSSBOG00000006927.1) URS00006292A1_39432

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AAUGUGAAGCAAAUGAUGAUAAACUGGAUCUGACUGACUGUGCUGAGUCUGUUCAAUCCAACCCUGAGCUUCAUGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

  1. Aotus nancymaae small nucleolar RNA, C/D box 69 (ENSANAG00000004484.1)
  2. Colobus angolensis palliatus snoRNA (ENSCANG00000007071.1)
  3. Gorilla gorilla gorilla Small nucleolar RNA SNORD69
  4. Homo sapiens (human) small nucleolar RNA, C/D box 69 (SNORD69)
  5. Nomascus leucogenys small nucleolar RNA, C/D box 69 (ENSNLEG00000026396.2)
  6. Pan paniscus small nucleolar RNA, C/D box 69 (ENSPPAG00000003271.1)
  7. Pan troglodytes small nucleolar RNA, C/D box 69 (ENSPTRG00000033370.2)
  8. Piliocolobus tephrosceles (Ugandan red Colobus) snoRNA (ENSPTEG00000037230.1)
  9. Pongo abelii small nucleolar RNA, C/D box 69 (ENSPPYG00000023918.2)
  10. Rhinopithecus bieti (Black snub-nosed monkey) small nucleolar RNA, C/D box 69 (ENSRBIG00000020181.1)
  11. Rhinopithecus roxellana small nucleolar RNA, C/D box 69 (ENSRROG00000020254.1)
 2D structure Publications