v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens lin-4 microRNA precursor URS000062858F_9606

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UCUCAGUCCCUGAGACCCUAACUUGUGAUGUUUACCGUUUAAAUCCACGGGUUAGGCUCUUGGGAGCUGCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Callithrix jacchus lin-4 microRNA precursor
  2. Cavia porcellus lin-4 microRNA precursor
  3. Chlorocebus sabaeus lin-4 microRNA precursor
  4. Fukomys damarensis lin-4 microRNA precursor
  5. Gorilla gorilla gorilla lin-4 microRNA precursor
  6. Heterocephalus glaber lin-4 microRNA precursor
  7. Macaca mulatta lin-4 microRNA precursor
  8. Marmota monax non-coding RNA
  9. Nomascus leucogenys lin-4 microRNA precursor
  10. Oryctolagus cuniculus lin-4 microRNA precursor
  11. Otolemur garnettii lin-4 microRNA precursor
  12. Pan troglodytes (chimpanzee) lin-4 microRNA precursor
  13. Papio anubis lin-4 microRNA precursor
  14. Pongo abelii (Sumatran orangutan) lin-4 microRNA precursor
  15. Ictidomys tridecemlineatus lin-4 microRNA precursor
  16. Sus scrofa lin-4 microRNA precursor
  17. Tupaia chinensis (Chinese tree shrew) lin-4 microRNA precursor
 Publications