Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Canis lupus familiaris (dog) cfa-miR-197 URS000061E740_9615

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

cfa-mir-197: Cfa-mir-197 is a microRNA that specifically binds to the 3′-UTR of KPNA6, mediating its silencing [PMC8779696]. In MDCK cells infected with influenza B virus, including the Victoria and Yamagata lineages, cfa-mir-197 is significantly upregulated [PMC8779696]. Luciferase reporter assays confirmed that KPNA6 is a putative target of cfa-mir-197 in MDCK cells [PMC6893747]. The expression of cfa-mir-197 and cfa-miR-215 is increased during influenza B virus infection [PMC6893747]. Overexpression of cfa-mir-197 reduces KPNA6 expression at the mRNA level, while inhibition of cfa-mir-197 leads to increased expression of KPNA6 and PB1 [PMC6893747]. The luciferase activity assays demonstrate that KPNA6 contains putative binding sites for cfa-mir-197 but not for cfa-miR-215 [PMC6893747]. Computational programs were used to predict target genes regulated by cfa-mir-197 and cfa-miR215 [PMC6893747]. The expression levels of both microRNAs are significantly higher in cells infected with the Yamagata lineage compared to the Victoria lineage [PMC6893747]. These findings suggest that KPNA6 may be directly regulated by both microRNAs, influencing influenza B virus replication [PMC6893747]. Overexpression of cfa-mir-197 leads to downregulation of KPNA6 and viral PB1 expression at later time points during infection [PMC6893747].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUCACCACCUUCUCCACCCAGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 17 other species

  1. Ateles geoffroyi age-miR-197
  2. Bos taurus (cattle) bta-miR-197
  3. Callithrix jacchus cja-miR-197
  4. Capra hircus (goat) chi-miR-197-3p
  5. Cavia porcellus (domestic guinea pig) cpo-miR-197-3p
  6. Cervus elaphus (red deer) cel-miR-197
  7. Equus caballus eca-miR-197
  8. Gorilla gorilla gorilla ggo-miR-197 (MIR197)
  9. Gorilla gorilla (western gorilla) ggo-miR-197
  10. Homo sapiens hsa-miR-197-3p
  11. Macaca mulatta (Rhesus monkey) mml-miR-197-3p
  12. Microcebus murinus (gray mouse lemur) mmr-miR-197
  13. Oryctolagus cuniculus ocu-miR-197-3p
  14. Otolemur garnettii (small-eared galago) oga-miR-197
  15. Pan paniscus ppa-miR-197
  16. Pan troglodytes (chimpanzee) ptr-miR-197
  17. Pongo pygmaeus (Bornean orangutan) ppy-miR-197
Publications