Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Cavia porcellus (domestic guinea pig) cpo-miR-197-3p URS000061E740_10141

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUCACCACCUUCUCCACCCAGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 17 other species

  1. Ateles geoffroyi age-miR-197
  2. Bos taurus (cattle) bta-miR-197
  3. Callithrix jacchus cja-miR-197
  4. Canis lupus familiaris cfa-miR-197
  5. Capra hircus (goat) chi-miR-197-3p
  6. Cervus elaphus (red deer) cel-miR-197
  7. Equus caballus eca-miR-197
  8. Gorilla gorilla gorilla ggo-miR-197 (MIR197)
  9. Gorilla gorilla (western gorilla) ggo-miR-197
  10. Homo sapiens hsa-miR-197-3p
  11. Macaca mulatta (Rhesus monkey) mml-miR-197-3p
  12. Microcebus murinus (gray mouse lemur) mmr-miR-197
  13. Oryctolagus cuniculus ocu-miR-197-3p
  14. Otolemur garnettii (small-eared galago) oga-miR-197
  15. Pan paniscus ppa-miR-197
  16. Pan troglodytes (chimpanzee) ptr-miR-197
  17. Pongo pygmaeus (Bornean orangutan) ppy-miR-197