Saguinus labiatus (red-chested mustached tamarin) sla-miR-128 URS000061CA23_78454

• 22 nucleotides
• 2 databases (ENA, miRBase)
• Found in 13 other species
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

UCACAGUGAACCGGUCUCUUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

1. Ateles geoffroyi age-miR-128
2. Bos taurus (cattle) microRNA miR-128a
3. Danio rerio dre-miR-128-3p
4. Macaca mulatta (Rhesus monkey) mml-miR-128a-3p
5. Mus musculus Mus_musculus piRNA piR-mmu-8213497
6. Ophiophagus hannah oha-miR-128-3p
7. Pan paniscus ppa-miR-128
8. Pan troglodytes (chimpanzee) microRNA mir-128a
9. Pongo pygmaeus (Bornean orangutan) microRNA mir-128a
10. Takifugu rubripes (torafugu) fru-miR-128
11. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-128
12. Tor tambroides (Thai mahseer) miR-128-3p
13. Xenopus tropicalis xtr-miR-128

Download

• FASTA
• JSON