v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Tor tambroides (Thai mahseer) miR-128-3p URS000061CA23_329116

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UCACAGUGAACCGGUCUCUUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

  1. Ateles geoffroyi age-miR-128
  2. Bos taurus (cattle) microRNA miR-128a
  3. Danio rerio dre-miR-128-3p
  4. Macaca mulatta (Rhesus monkey) mml-miR-128a-3p
  5. Mus musculus Mus_musculus piRNA piR-mmu-8213497
  6. Ophiophagus hannah oha-miR-128-3p
  7. Pan paniscus ppa-miR-128
  8. Pan troglodytes (chimpanzee) microRNA mir-128a
  9. Pongo pygmaeus (Bornean orangutan) microRNA mir-128a
  10. Saguinus labiatus sla-miR-128
  11. Takifugu rubripes (torafugu) fru-miR-128
  12. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-128
  13. Xenopus tropicalis xtr-miR-128