Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Semnopithecus entellus tRNA-Met secondary structure diagram

Semnopithecus entellus tRNA-Met URS000060EDEE_88029

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGUAAGGUCAGCUAAAUAAGCUAUCGGGCCCAUACCCCGAAAAUGUUGGUUAUACCCUUCCCAUACUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 5 other species

  1. Homo sapiens tRNA-Met
  2. Hoolock hoolock tRNA-Met
  3. Hoolock leuconedys tRNA-Met
  4. Hoolock leuconedys x Hoolock tianxing tRNA-Met
  5. Symphalangus syndactylus (siamang) Met-tRNA
2D structure