v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Hoolock leuconedys (eastern hoolock gibbon) tRNA-Met secondary structure diagram

Hoolock leuconedys (eastern hoolock gibbon) tRNA-Met URS000060EDEE_593543

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AGUAAGGUCAGCUAAAUAAGCUAUCGGGCCCAUACCCCGAAAAUGUUGGUUAUACCCUUCCCAUACUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 5 other species

  1. Homo sapiens tRNA-Met
  2. Hoolock hoolock tRNA-Met
  3. Hoolock leuconedys x Hoolock tianxing tRNA-Met
  4. Semnopithecus entellus tRNA-Met
  5. Symphalangus syndactylus (siamang) Met-tRNA
 2D structure