Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-140 URS00005BBC9A_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-140: Bta-mir-140 is a miRNA that has been detected in various studies and is part of the top 10 most abundantly expressed miRNA families in bovine species [PMC5003961]. It has been found to be expressed across the bovine estrous cycle without differences among the stages [PMC7969882]. In one study, bta-mir-140 was found to be up-regulated in OF-sEV/Pregnant and down-regulated in OF-sEV/Non-pregnant groups [PMC7969882]. Another study found that bta-mir-140 had a higher number of copies during the spring compared to summer and fall [PMC4990326]. It was also upregulated in older animals and fetal muscle tissue [PMC4990326]. In the context of embryo development, bta-mir-140 was downregulated in EVs secreted by arrested embryos but upregulated in EVs from competent embryos [PMC7727673]. Additionally, bta-mir-140 was found to be regulated both in skeletal muscle and mammary tissue [PMC5325256]. It is one of the known miRNAs with a broad range of expression, with thousands of sequence reads for the most abundant miRNAs such as bta-mir-21 and bta-mir-140 [PMC2713767]. Finally, bta-mir-140 has been detected with different abundance levels among cows at embryo transfer [PMC5662615]. Overall, these studies highlight the presence and potential regulatory role of bta-mir-140 across different biological processes.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UACCACAGGGUAGAACCACGGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

  1. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-140
  2. Capra hircus (goat) miR-140*
  3. Chiloscyllium plagiosum microRNA cpl-miR-140-3p
  4. Chrysemys picta cpi-miR-140-3p
  5. Cyprinus carpio ccr-miR-140-3p
  6. Monodelphis domestica mdo-miR-140-3p
  7. Mus musculus Mus_musculus piRNA piR-mmu-6799231
  8. Ornithorhynchus anatinus oan-miR-140-3p
  9. Ovis aries miscellaneous RNA
  10. Salmo salar (Atlantic salmon) ssa-miR-140-3p
  11. Xenopus laevis xla-miR-140-3p
  12. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-3944954
Publications