v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Xenopus tropicalis (tropical clawed frog) Xenopus_tropicalis piRNA piR-xtr-3944954 URS00005BBC9A_8364

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UACCACAGGGUAGAACCACGGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

  1. Bos taurus (cattle) bta-miR-140
  2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-140
  3. Capra hircus (goat) miR-140*
  4. Chiloscyllium plagiosum microRNA cpl-miR-140-3p
  5. Chrysemys picta cpi-miR-140-3p
  6. Cyprinus carpio ccr-miR-140-3p
  7. Monodelphis domestica mdo-miR-140-3p
  8. Mus musculus Mus_musculus piRNA piR-mmu-6799231
  9. Ornithorhynchus anatinus oan-miR-140-3p
  10. Ovis aries miscellaneous RNA
  11. Salmo salar (Atlantic salmon) ssa-miR-140-3p
  12. Xenopus laevis xla-miR-140-3p