Homo sapiens neanderthalensis tRNA-Arg

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens neanderthalensis tRNA-Arg URS00005983A6_63221

65 nucleotides
1 database (ENA)
Found in 4 other species
1. sncRNA
2. tRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

UGGUAUAUAGUUUAAACAAAACGAAUGAUUUCGACUCAUUAAAUUAUGAUAAUCAUAUUUACCAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

Cloning vector pRS316-1B9 tRNA-Arg
Homo heidelbergensis (Heidelberg man) tRNA-Arg
Homo sapiens mitochondrially encoded tRNA-Arg (CGN) (MT-TR)
Homo sapiens subsp. 'Denisova' subsp. 'Denisova' (Denisova hominin) transfer RNA-Arg

2D structure