v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Cloning vector pRS316-1B9 tRNA-Arg secondary structure diagram

Cloning vector pRS316-1B9 tRNA-Arg URS00005983A6_1054602

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGGUAUAUAGUUUAAACAAAACGAAUGAUUUCGACUCAUUAAAUUAUGAUAAUCAUAUUUACCAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

  1. Homo heidelbergensis (Heidelberg man) tRNA-Arg
  2. Homo sapiens mitochondrially encoded tRNA-Arg (CGN) (MT-TR)
  3. Homo sapiens neanderthalensis neanderthalensis tRNA-Arg
  4. Homo sapiens subsp. 'Denisova' subsp. 'Denisova' (Denisova hominin) transfer RNA-Arg
 2D structure