Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Danio rerio (zebrafish) dre-let-7e URS0000591093_7955

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

dre-let-7e: dre-let-7e is a type of miRNA that has been evaluated for its stability in different experimental conditions [PMC8613261]. BestKeeper, a software tool for evaluating miRNA stability, ranked dre-let-7e as the least stable candidate among the normalization candidates in unsorted values [PMC8613261]. In the same study, dre-let-7e was also ranked as the second least stable candidate among potential endogenous controls within a morpholino subset [PMC8613261]. When considering strains only, dre-let-7e was again ranked as the least stable candidate among the evaluated miRNAs [PMC8613261]. These rankings were determined based on stability values assigned by BestKeeper, with lower values indicating higher stability [PMC8613261]. The rankings provide insights into the relative stability of dre-let-7e compared to other miRNAs in different experimental contexts [PMC8613261]. The information can be useful for researchers studying dre-let-7e and considering its suitability as a normalization candidate or endogenous control in their experiments [PMC8613261].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAGGUAGUAGAUUGAAUAGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 29 other species

  1. Alligator mississippiensis (American alligator) ami-let-7e-5p
  2. Anolis carolinensis (green anole) aca-let-7e-5p
  3. Cervus elaphus (red deer) cel-let-7e
  4. Chrysemys picta bellii Cpi-Let-7-P2a4_5p (mature (guide))
  5. Chrysemys picta (Painted turtle) cpi-let-7e-5p
  6. Columba livia cli-let-7e-5p
  7. Gadus morhua gmo-let-7e-5p
  8. Gallus gallus gga-let-7k-5p
  9. Gekko japonicus Gja-Let-7-P2a4_5p (mature (guide))
  10. Haplochromis burtoni (Burton's mouthbrooder) abu-let-7e
  11. Ictalurus punctatus (channel catfish) ipu-let-7e
  12. Latimeria chalumnae Lch-Let-7-P2a4_5p (mature (guide))
  13. Lepisosteus oculatus (spotted gar) Loc-Let-7-P2a4_5p (mature (guide))
  14. Maylandia zebra (zebra mbuna) mze-let-7e
  15. Microcaecilia unicolor Mun-Let-7-P2a4_5p (mature (guide))
  16. Monopterus albus Mal-Let-7-P2a4b_5p (mature (guide))
  17. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-49426673
  18. Neolamprologus brichardi (lyretail cichlid) nbr-let-7e
  19. Ophiophagus hannah oha-let-7e-5p
  20. Oreochromis niloticus oni-let-7e
  21. Ornithorhynchus anatinus (platypus) oan-let-7e-5p
  22. Pundamilia nyererei pny-let-7e
  23. Python bivittatus (Burmese python) pbv-let-7e-5p
  24. Salmo salar ssa-let-7e-5p
  25. Sphenodon punctatus (tuatara) Spt-Let-7-P2a4_5p (mature (guide))
  26. Taeniopygia guttata tgu-let-7e-5p
  27. Takifugu rubripes fru-let-7e
  28. Tetraodon nigroviridis (spotted green pufferfish) tni-let-7e
  29. Tor tambroides let-7e
Publications