Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Taeniopygia guttata (zebra finch) tgu-let-7e-5p URS0000591093_59729

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAGGUAGUAGAUUGAAUAGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 29 other species

  1. Alligator mississippiensis (American alligator) ami-let-7e-5p
  2. Anolis carolinensis (green anole) aca-let-7e-5p
  3. Cervus elaphus (red deer) cel-let-7e
  4. Chrysemys picta bellii Cpi-Let-7-P2a4_5p (mature (guide))
  5. Chrysemys picta (Painted turtle) cpi-let-7e-5p
  6. Columba livia cli-let-7e-5p
  7. Danio rerio (zebrafish) dre-let-7e
  8. Gadus morhua gmo-let-7e-5p
  9. Gallus gallus gga-let-7k-5p
  10. Gekko japonicus Gja-Let-7-P2a4_5p (mature (guide))
  11. Haplochromis burtoni (Burton's mouthbrooder) abu-let-7e
  12. Ictalurus punctatus (channel catfish) ipu-let-7e
  13. Latimeria chalumnae Lch-Let-7-P2a4_5p (mature (guide))
  14. Lepisosteus oculatus (spotted gar) Loc-Let-7-P2a4_5p (mature (guide))
  15. Maylandia zebra (zebra mbuna) mze-let-7e
  16. Microcaecilia unicolor Mun-Let-7-P2a4_5p (mature (guide))
  17. Monopterus albus Mal-Let-7-P2a4b_5p (mature (guide))
  18. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-49426673
  19. Neolamprologus brichardi (lyretail cichlid) nbr-let-7e
  20. Ophiophagus hannah oha-let-7e-5p
  21. Oreochromis niloticus oni-let-7e
  22. Ornithorhynchus anatinus (platypus) oan-let-7e-5p
  23. Pundamilia nyererei pny-let-7e
  24. Python bivittatus (Burmese python) pbv-let-7e-5p
  25. Salmo salar ssa-let-7e-5p
  26. Sphenodon punctatus (tuatara) Spt-Let-7-P2a4_5p (mature (guide))
  27. Takifugu rubripes fru-let-7e
  28. Tetraodon nigroviridis (spotted green pufferfish) tni-let-7e
  29. Tor tambroides let-7e
Publications