Gorilla gorilla (western gorilla) microRNA ggo-mir-187 precursor

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gorilla gorilla (western gorilla) microRNA ggo-mir-187 precursor URS00005677F7_9593

109 nucleotides
2 databases (ENA, miRBase)
Found in 6 other species
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

GGUCGGGCUCACCAUGACACAGUGUGAGACCUCGGGCUACAACACAGGACCCGGGCGCUGCUCUGACCCCUCGUGUCUUGUGUUGCAGCCGGAGGGACGCAGGUCCGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 6 other species

Cebus imitator microRNA 187 (ENSCCAG00000020127.1)
Gorilla gorilla gorilla (Western Lowland Gorilla) ggo-mir-187 (ENSGGOG00000028703.2)
Homo sapiens (human) microRNA hsa-mir-187 precursor
Pan paniscus (pygmy chimpanzee) microRNA ppa-mir-187 precursor