Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-187 precursor URS00005677F7_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR187: MIR187 is a microRNA that is associated with the regulation of the potassium channel KCNK10/TREK-2 in a rat epilepsy model [PMC7041117]. It acts as a negative modulator of LPS responses by limiting TNF-α production and reducing IL-6 and IL-12p40 transcription [PMC5900789]. Through a complex network of miRNAs, MIR187 is upregulated by IL-10, which drives anti-inflammatory responses [PMC5900789]. In the context of recurrent pregnancy loss (RPL), MIR187 is significantly overexpressed in the villus of RPL women [PMC5572592]. It has also been identified as induced in RPL and suppressed in miR100, let7a, let7b, let7c, and miR21 [PMC4495342]. IL-10 has been shown to regulate the expression of MIR187 along with other miRNAs such as miR-155 and miR-146a/b [PMC5161420]. In immune infiltration studies, MIR187 expression levels were found to be highest in high-infiltrating groups compared to median-infiltrating and low-infiltrating groups [PMC7163112]. Additionally, MIR187 has been associated with immune responses along with other noncoding RNAs such as mir142, mir223, mir155, mir200a/b [PMC7163112]. Further research exploring the relationships between noncoding RNAs and immune responses is warranted [PMC7163112].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGUCGGGCUCACCAUGACACAGUGUGAGACCUCGGGCUACAACACAGGACCCGGGCGCUGCUCUGACCCCUCGUGUCUUGUGUUGCAGCCGGAGGGACGCAGGUCCGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications