Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Python bivittatus (Burmese python) Pbv-Mir-184_3p (mature (guide)) URS0000543D82_176946

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGACGGAGAACUGAUAAGGGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 34 other species

  1. Alligator mississippiensis (American alligator) ami-miR-184-3p
  2. Anolis carolinensis aca-miR-184-3p
  3. Bos taurus (cattle) bta-miR-184
  4. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-184
  5. Canis lupus familiaris (dog) cfa-miR-184
  6. Capra hircus chi-miR-184
  7. Cavia porcellus cpo-miR-184-3p
  8. Cervus elaphus (red deer) cel-miR-184
  9. Chrysemys picta bellii Cpi-Mir-184_3p (mature (guide))
  10. Chrysemys picta (Painted turtle) cpi-miR-184-3p
  11. Columba livia (rock pigeon) cli-miR-184-3p
  12. Cricetulus griseus (Chinese hamster) cgr-miR-184
  13. Dasypus novemcinctus (nine-banded armadillo) dno-miR-184-3p
  14. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-184_3p (mature (guide))
  15. Equus caballus eca-miR-184
  16. Gallus gallus gga-miR-184-3p
  17. Gekko japonicus Gja-Mir-184_3p (mature (guide))
  18. Homo sapiens (human) hsa-miR-184
  19. Macaca mulatta (Rhesus monkey) mml-miR-184
  20. Macaca nemestrina mne-miR-184
  21. Monodelphis domestica (gray short-tailed opossum) mdo-miR-184-3p
  22. Monopterus albus (swamp eel) Mal-Mir-184-P1_3p (mature (guide))
  23. Mus musculus (house mouse) mmu-miR-184-3p
  24. Oryctolagus cuniculus ocu-miR-184-3p
  25. Otolemur garnettii (small-eared galago) oga-miR-184
  26. Pan troglodytes ptr-miR-184
  27. Pongo pygmaeus ppy-miR-184
  28. Pteropus alecto pal-miR-184-3p
  29. Rattus norvegicus (Norway rat) rno-miR-184
  30. Sarcophilus harrisii Sha-Mir-184_3p (mature (guide))
  31. Sphenodon punctatus Spt-Mir-184_3p (mature (guide))
  32. Sus scrofa ssc-miR-184
  33. Taeniopygia guttata (zebra finch) tgu-miR-184
  34. Tupaia chinensis (Chinese tree shrew) tch-miR-184