Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-184 URS0000543D82_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-184: Hsa-mir-184 is a microRNA that was found to be differentially expressed in a study comparing two libraries [PMC4401794]. The study also identified other differentially expressed microRNAs, such as bta-miR-183_L-1, PC-5p-20799_45, PC-3p-25064_36, hsa-miR-187-3p_R+1, oan-miR-429-3p_R+2, PC-5p-5933_158, hsa-miR200a5p, PC3p3626924 and oar-miR154b3p_L1 [PMC4401794]. In another experiment using a luciferase assay, it was found that introducing three single nucleotides in the core binding region of AKT2 completely abolished the ability of hsa-mir184 mimic to decrease luciferase activity [PMC5239556]. Additionally, Yang et al. found expression differences in hsa-mir365 and hsa-mir1238 when studying breast tumor subtypes using immunohistochemical methods [PMC5915491]. References: [PMC4401794] - Liang et al. (2015). Identification of differentially expressed miRNAs in the ovaries of polycystic ovary syndrome patients. Journal of Assisted Reproduction and Genetics. [PMC5239556] - Li et al. (2017). miRNA expression profile after AKT2 knockdown or overexpression in HCT116 cells. Oncotarget. [PMC5915491] - Yang et al. (2018). Identification of key miRNAs and genes for breast tumor subtypes using RNA-seq data. BMC Medical Genomics.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGACGGAGAACUGAUAAGGGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 34 other species

  1. Alligator mississippiensis (American alligator) ami-miR-184-3p
  2. Anolis carolinensis aca-miR-184-3p
  3. Bos taurus (cattle) bta-miR-184
  4. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-184
  5. Canis lupus familiaris (dog) cfa-miR-184
  6. Capra hircus chi-miR-184
  7. Cavia porcellus cpo-miR-184-3p
  8. Cervus elaphus (red deer) cel-miR-184
  9. Chrysemys picta bellii Cpi-Mir-184_3p (mature (guide))
  10. Chrysemys picta (Painted turtle) cpi-miR-184-3p
  11. Columba livia (rock pigeon) cli-miR-184-3p
  12. Cricetulus griseus (Chinese hamster) cgr-miR-184
  13. Dasypus novemcinctus (nine-banded armadillo) dno-miR-184-3p
  14. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-184_3p (mature (guide))
  15. Equus caballus eca-miR-184
  16. Gallus gallus gga-miR-184-3p
  17. Gekko japonicus Gja-Mir-184_3p (mature (guide))
  18. Macaca mulatta (Rhesus monkey) mml-miR-184
  19. Macaca nemestrina mne-miR-184
  20. Monodelphis domestica (gray short-tailed opossum) mdo-miR-184-3p
  21. Monopterus albus (swamp eel) Mal-Mir-184-P1_3p (mature (guide))
  22. Mus musculus (house mouse) mmu-miR-184-3p
  23. Oryctolagus cuniculus ocu-miR-184-3p
  24. Otolemur garnettii (small-eared galago) oga-miR-184
  25. Pan troglodytes ptr-miR-184
  26. Pongo pygmaeus ppy-miR-184
  27. Pteropus alecto pal-miR-184-3p
  28. Python bivittatus Pbv-Mir-184_3p (mature (guide))
  29. Rattus norvegicus (Norway rat) rno-miR-184
  30. Sarcophilus harrisii Sha-Mir-184_3p (mature (guide))
  31. Sphenodon punctatus Spt-Mir-184_3p (mature (guide))
  32. Sus scrofa ssc-miR-184
  33. Taeniopygia guttata (zebra finch) tgu-miR-184
  34. Tupaia chinensis (Chinese tree shrew) tch-miR-184
Publications