v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Cervus elaphus (red deer) cel-mir-128-1-p5 URS0000537082_9860

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CGGGGCCGUAGCACUGUCUGAGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Capra hircus (goat) chi-miR-128-5p
  2. Cavia porcellus cpo-miR-128-5p
  3. Cricetulus griseus (Chinese hamster) cgr-miR-128-5p
  4. Dasypus novemcinctus dno-miR-128-5p
  5. Homo sapiens hsa-miR-128-1-5p
  6. Macaca mulatta (Rhesus monkey) mml-miR-128a-5p
  7. Monodelphis domestica mdo-miR-128b-5p
  8. Mus musculus Mus_musculus piRNA piR-mmu-49608837
  9. Oryctolagus cuniculus ocu-miR-128a-5p
  10. Pteropus alecto pal-miR-128-5p