Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pteropus alecto (black flying fox) pal-miR-128-5p URS0000537082_9402

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CGGGGCCGUAGCACUGUCUGAGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Capra hircus (goat) chi-miR-128-5p
  2. Cavia porcellus cpo-miR-128-5p
  3. Cervus elaphus cel-mir-128-1-p5
  4. Cricetulus griseus (Chinese hamster) cgr-miR-128-5p
  5. Dasypus novemcinctus dno-miR-128-5p
  6. Homo sapiens hsa-miR-128-1-5p
  7. Macaca mulatta (Rhesus monkey) mml-miR-128a-5p
  8. Monodelphis domestica mdo-miR-128b-5p
  9. Mus musculus Mus_musculus piRNA piR-mmu-49608837
  10. Oryctolagus cuniculus ocu-miR-128a-5p