Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Cervus elaphus (red deer) cel-miR-125b URS00004FCB5F_9860

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACAAGUCAGGCUCUUGGGACCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

  1. Cavia porcellus (domestic guinea pig) cpo-miR-125b-2-3p
  2. Chrysemys picta (Painted turtle) cpi-miR-125b-2-3p
  3. Columba livia cli-miR-125-2-3p
  4. Dasypus novemcinctus (nine-banded armadillo) dno-miR-125b-2-3p
  5. Gallus gallus gga-miR-125b-3p
  6. Homo sapiens Hsa-Mir-10-P3c_3p* (star (passenger))
  7. Macaca mulatta mml-miR-125b-2-3p
  8. Oryctolagus cuniculus ocu-miR-125b-2-3p
  9. Python bivittatus (Burmese python) pbv-miR-125b-3p
  10. Rattus norvegicus rno-miR-125b-2-3p
  11. Taeniopygia guttata tgu-miR-125-1-3p