Dasypus novemcinctus (nine-banded armadillo) dno-miR-125b-2-3p

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Dasypus novemcinctus (nine-banded armadillo) dno-miR-125b-2-3p URS00004FCB5F_9361

22 nucleotides
1 database (miRBase)
Found in 11 other species

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

ACAAGUCAGGCUCUUGGGACCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

Cavia porcellus (domestic guinea pig) cpo-miR-125b-2-3p
Cervus elaphus cel-miR-125b
Chrysemys picta (Painted turtle) cpi-miR-125b-2-3p
Columba livia cli-miR-125-2-3p
Gallus gallus gga-miR-125b-3p
Homo sapiens Hsa-Mir-10-P3c_3p* (star (passenger))
Macaca mulatta mml-miR-125b-2-3p
Oryctolagus cuniculus ocu-miR-125b-2-3p
Python bivittatus (Burmese python) pbv-miR-125b-3p
Rattus norvegicus rno-miR-125b-2-3p
Taeniopygia guttata tgu-miR-125-1-3p