Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Canis lupus familiaris tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 7) secondary structure diagram

Canis lupus familiaris tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 7) URS00004F0321_9615

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGCUCUCACCGCCGCGGCCCGGGUUCGAUUCCCGGUCAGGGAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 169 other species

  1. Acanthisitta chloris tRNA
  2. Acinetobacter baumannii tRNA-Glu
  3. Ailuropoda melanoleuca tRNA-Glu (CTC) (tRNA-Glu-CTC-2 1 to 4)
  4. Albula glossodonta (roundjaw bonefish) tRNA-OTHER
  5. Albula goreensis tRNA-Glu
  6. Alligator mississippiensis tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 5)
  7. Alligator sinensis tRNA
  8. Alosa alosa tRNA-Glu
  9. Amazona aestiva tRNA
  10. Ameiurus melas (black bullhead) tRNA-Glu
  11. Anas platyrhynchos tRNA
  12. Anguilla anguilla (European eel) tRNA-Glu
  13. Anolis carolinensis tRNA-Glu (CTC) (tRNA-Glu-CTC-1-1)
  14. Apaloderma vittatum tRNA
  15. Aptenodytes forsteri tRNA
  16. Astyanax mexicanus tRNA
  17. Ataeniobius toweri tRNA-Glu
  18. Balaenoptera acutorostrata scammoni tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 7)
  19. Balearica regulorum gibbericeps tRNA
  20. Bos taurus tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 8)
  21. Buceros rhinoceros silvestris tRNA
  22. Callipepla squamata (scaled quail) tRNA
  23. Callithrix jacchus tRNA-Glu (CTC) (tRNA-Glu-CTC-2 1 to 7)
  24. Callorhinchus milii tRNA-Glu (CTC) (tRNA-Glu-CTC-2-1)
  25. Calypte anna tRNA
  26. Camelus ferus tRNA
  27. Antrostomus carolinensis tRNA
  28. Cariama cristata (red-legged seriema) tRNA
  29. Cathartes aura tRNA
  30. Cavia porcellus tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 5)
  31. Ceratotherium simum simum tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 5)
  32. Chaetura pelagica (chimney swift) tRNA
  33. Characodon lateralis tRNA-Glu
  34. Charadrius vociferus tRNA
  35. Chelonia mydas tRNA
  36. Chelydra serpentina tRNA-Glu
  37. Chlamydotis macqueenii tRNA
  38. Chlorocebus sabaeus tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 5)
  39. Choloepus hoffmanni tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 4)
  40. Chrysemys picta bellii tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 3)
  41. Colinus virginianus (northern bobwhite) tRNA
  42. Colius striatus tRNA
  43. Columba livia tRNA
  44. Corvus brachyrhynchos tRNA
  45. Crenichthys baileyi tRNA-Glu
  46. Cricetulus griseus tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 8)
  47. Cuculus canorus (common cuckoo) tRNA
  48. Dallia pectoralis tRNA-Glu
  49. Danionella translucida tRNA-Glu
  50. Danio rerio tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 130)
  51. Dasypus novemcinctus tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 8)
  52. Dicentrarchus labrax transfer RNA-Glu
  53. Dipodomys ordii tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 11)
  54. Echinops telfairi tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 4)
  55. Egretta garzetta tRNA
  56. Eptesicus nilssonii tRNA-Glu
  57. Equus caballus tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 4)
  58. Erinaceus europaeus tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 6)
  59. Eurypyga helias (sunbittern) tRNA
  60. Felis catus tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 7)
  61. Ficedula albicollis tRNA
  62. Fukomys damarensis (Damara mole-rat) tRNA
  63. Fulmarus glacialis tRNA
  64. Gadus morhua tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 13)
  65. Gallus gallus tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 6)
  66. Gasterosteus aculeatus (three-spined stickleback) tRNA
  67. Gavia stellata tRNA
  68. Geospiza fortis tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 5)
  69. Gorilla gorilla gorilla tRNA-Glu (CTC) (tRNA-Glu-CTC-1 2 to 5, tRNA-Glu-CTC-2-1)
  70. Haliaeetus albicilla (white-tailed eagle) tRNA
  71. Heterocephalus glaber tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 4)
  72. Hippoglossus stenolepis tRNA-Glu
  73. Homo sapiens tRNA-Glu (anticodon CTC) 1-1 (TRE-CTC1 1 to 7)
  74. Ictidomys tridecemlineatus tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 4)
  75. Lamprotornis superbus tRNA-OTHER
  76. Larimichthys crocea tRNA
  77. Latimeria chalumnae tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 3)
  78. Lepisosteus oculatus (spotted gar) tRNA
  79. Leptotrombidium deliense tRNA-Glu for anticodon CUC
  80. Liparis tanakae tRNA-Glu
  81. Lonchura striata domestica (Bengalese finch) tRNA
  82. Loxodonta africana tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 6)
  83. Macaca mulatta tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 3)
  84. Manacus vitellinus (golden-collared manakin) tRNA
  85. Marmota monax tRNA.Glu
  86. Megalops atlanticus (tarpon) tRNA-Glu
  87. Meleagris gallopavo tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 9)
  88. Melopsittacus undulatus tRNA-Glu (CTC) (tRNA-Glu-CTC-1-1)
  89. Merluccius polli tRNA-Glu
  90. Merops nubicus tRNA
  91. Mesitornis unicolor (brown roatelo) tRNA
  92. Mesocricetus auratus (golden hamster) tRNA
  93. Microcebus murinus tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 8)
  94. Micromonospora sp. RP3T tRNA-Glu
  95. Monodelphis domestica tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 11)
  96. Mus caroli tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 6)
  97. Mus musculus castaneus tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 6)
  98. Mus musculus domesticus tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 7)
  99. Mus musculus musculus tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 8)
  100. Mus musculus tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 9)
  101. Mus pahari tRNA-Glu (CTC) (tRNA-Glu-CTC-2 1 to 6)
  102. Mus spretus tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 6)
  103. Mustela putorius furo tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 5)
  104. Myotis brandtii tRNA
  105. Myotis davidii tRNA
  106. Myotis lucifugus tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 6)
  107. Neotoma lepida (desert woodrat) tRNA
  108. Nestor notabilis tRNA
  109. Nipponia nippon (crested ibis) tRNA
  110. Nomascus leucogenys tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 6)
  111. Notamacropus eugenii tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 6)
  112. Nothobranchius furzeri tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 5)
  113. Ochotona princeps tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 7)
  114. Ophiophagus hannah (king cobra) tRNA
  115. Opisthocomus hoazin tRNA
  116. Oreochromis niloticus tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 13)
  117. Ornithorhynchus anatinus tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 12)
  118. Oryctolagus cuniculus tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 15)
  119. Oryzias latipes tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 17)
  120. Otolemur garnettii tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 7)
  121. Ovis aries tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 5)
  122. Pangasianodon gigas tRNA-Glu
  123. Pangasianodon hypophthalmus tRNA-Glu
  124. Pangasius djambal tRNA-Glu
  125. Pan troglodytes tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 3, tRNA-Glu-CTC-1-6)
  126. Papio anubis tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 8)
  127. Patagioenas fasciata monilis tRNA
  128. Pelecanus crispus tRNA
  129. Pelobates cultripes tRNA.Glu
  130. Pelodiscus sinensis tRNA
  131. Perca flavescens tRNA-Glu
  132. Perca fluviatilis (European perch) tRNA-Glu
  133. Petromyzon marinus tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 8)
  134. Phaethon lepturus tRNA
  135. Phalacrocorax carbo (great cormorant) tRNA
  136. Phoenicopterus ruber ruber tRNA
  137. Phrynosoma platyrhinos tRNA-OTHER
  138. Dryobates pubescens tRNA
  139. Plasmodium ovale wallikeri tRNA
  140. Pleuronectes platessa (European plaice) tRNA-Glu
  141. Podarcis lilfordi tRNA.Glu
  142. Podiceps cristatus (great crested grebe) tRNA
  143. Poecilia formosa tRNA
  144. Pongo abelii tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 5)
  145. Procavia capensis tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 5)
  146. Pterocles gutturalis tRNA
  147. Pteropus alecto (black flying fox) tRNA
  148. Pygoscelis adeliae tRNA
  149. Rattus norvegicus tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 12)
  150. Saimiri boliviensis boliviensis tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 4)
  151. Salmo salar (Atlantic salmon) tRNA
  152. Sarcophilus harrisii tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 9)
  153. Scleropages formosus tRNA
  154. Sorex araneus tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 10)
  155. Sphaerodactylus townsendi tRNA-Glu
  156. Struthio camelus australis tRNA
  157. Sus scrofa tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 11)
  158. Taeniopygia guttata tRNA-Glu (CTC) (tRNA-Glu-CTC-1-1, tRNA-Glu-CTC-1-2)
  159. Takifugu rubripes tRNA-Glu (CTC) (tRNA-Glu-CTC-3 1 to 7)
  160. Tauraco erythrolophus tRNA
  161. Tetraodon nigroviridis tRNA
  162. Tinamus guttatus tRNA
  163. Trichechus manatus latirostris tRNA-Glu (CTC) (tRNA-Glu-CTC-2-1)
  164. Tupaia chinensis (Chinese tree shrew) tRNA
  165. Tursiops truncatus tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 4)
  166. Vicugna pacos tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 5)
  167. Xenopus laevis tRNA
  168. Xenopus tropicalis tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 41)
  169. Xiphophorus maculatus tRNA
2D structure Publications