Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Phrynosoma platyrhinos (Desert horned lizard) tRNA-OTHER secondary structure diagram

Phrynosoma platyrhinos (Desert horned lizard) tRNA-OTHER URS00004F0321_52577

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGCUCUCACCGCCGCGGCCCGGGUUCGAUUCCCGGUCAGGGAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 169 other species

  1. Acanthisitta chloris tRNA
  2. Acinetobacter baumannii tRNA-Glu
  3. Ailuropoda melanoleuca tRNA-Glu (CTC) (tRNA-Glu-CTC-2 1 to 4)
  4. Albula glossodonta (roundjaw bonefish) tRNA-OTHER
  5. Albula goreensis tRNA-Glu
  6. Alligator mississippiensis tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 5)
  7. Alligator sinensis tRNA
  8. Alosa alosa tRNA-Glu
  9. Amazona aestiva tRNA
  10. Ameiurus melas (black bullhead) tRNA-Glu
  11. Anas platyrhynchos tRNA
  12. Anguilla anguilla (European eel) tRNA-Glu
  13. Anolis carolinensis tRNA-Glu (CTC) (tRNA-Glu-CTC-1-1)
  14. Apaloderma vittatum tRNA
  15. Aptenodytes forsteri tRNA
  16. Astyanax mexicanus tRNA
  17. Ataeniobius toweri tRNA-Glu
  18. Balaenoptera acutorostrata scammoni tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 7)
  19. Balearica regulorum gibbericeps tRNA
  20. Bos taurus tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 8)
  21. Buceros rhinoceros silvestris tRNA
  22. Callipepla squamata (scaled quail) tRNA
  23. Callithrix jacchus tRNA-Glu (CTC) (tRNA-Glu-CTC-2 1 to 7)
  24. Callorhinchus milii tRNA-Glu (CTC) (tRNA-Glu-CTC-2-1)
  25. Calypte anna tRNA
  26. Camelus ferus tRNA
  27. Canis lupus familiaris tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 7)
  28. Antrostomus carolinensis tRNA
  29. Cariama cristata (red-legged seriema) tRNA
  30. Cathartes aura tRNA
  31. Cavia porcellus tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 5)
  32. Ceratotherium simum simum tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 5)
  33. Chaetura pelagica (chimney swift) tRNA
  34. Characodon lateralis tRNA-Glu
  35. Charadrius vociferus tRNA
  36. Chelonia mydas tRNA
  37. Chelydra serpentina tRNA-Glu
  38. Chlamydotis macqueenii tRNA
  39. Chlorocebus sabaeus tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 5)
  40. Choloepus hoffmanni tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 4)
  41. Chrysemys picta bellii tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 3)
  42. Colinus virginianus (northern bobwhite) tRNA
  43. Colius striatus tRNA
  44. Columba livia tRNA
  45. Corvus brachyrhynchos tRNA
  46. Crenichthys baileyi tRNA-Glu
  47. Cricetulus griseus tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 8)
  48. Cuculus canorus (common cuckoo) tRNA
  49. Dallia pectoralis tRNA-Glu
  50. Danionella translucida tRNA-Glu
  51. Danio rerio tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 130)
  52. Dasypus novemcinctus tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 8)
  53. Dicentrarchus labrax transfer RNA-Glu
  54. Dipodomys ordii tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 11)
  55. Echinops telfairi tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 4)
  56. Egretta garzetta tRNA
  57. Eptesicus nilssonii tRNA-Glu
  58. Equus caballus tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 4)
  59. Erinaceus europaeus tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 6)
  60. Eurypyga helias (sunbittern) tRNA
  61. Felis catus tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 7)
  62. Ficedula albicollis tRNA
  63. Fukomys damarensis (Damara mole-rat) tRNA
  64. Fulmarus glacialis tRNA
  65. Gadus morhua tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 13)
  66. Gallus gallus tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 6)
  67. Gasterosteus aculeatus (three-spined stickleback) tRNA
  68. Gavia stellata tRNA
  69. Geospiza fortis tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 5)
  70. Gorilla gorilla gorilla tRNA-Glu (CTC) (tRNA-Glu-CTC-1 2 to 5, tRNA-Glu-CTC-2-1)
  71. Haliaeetus albicilla (white-tailed eagle) tRNA
  72. Heterocephalus glaber tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 4)
  73. Hippoglossus stenolepis tRNA-Glu
  74. Homo sapiens tRNA-Glu (anticodon CTC) 1-1 (TRE-CTC1 1 to 7)
  75. Ictidomys tridecemlineatus tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 4)
  76. Lamprotornis superbus tRNA-OTHER
  77. Larimichthys crocea tRNA
  78. Latimeria chalumnae tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 3)
  79. Lepisosteus oculatus (spotted gar) tRNA
  80. Leptotrombidium deliense tRNA-Glu for anticodon CUC
  81. Liparis tanakae tRNA-Glu
  82. Lonchura striata domestica (Bengalese finch) tRNA
  83. Loxodonta africana tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 6)
  84. Macaca mulatta tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 3)
  85. Manacus vitellinus (golden-collared manakin) tRNA
  86. Marmota monax tRNA.Glu
  87. Megalops atlanticus (tarpon) tRNA-Glu
  88. Meleagris gallopavo tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 9)
  89. Melopsittacus undulatus tRNA-Glu (CTC) (tRNA-Glu-CTC-1-1)
  90. Merluccius polli tRNA-Glu
  91. Merops nubicus tRNA
  92. Mesitornis unicolor (brown roatelo) tRNA
  93. Mesocricetus auratus (golden hamster) tRNA
  94. Microcebus murinus tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 8)
  95. Micromonospora sp. RP3T tRNA-Glu
  96. Monodelphis domestica tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 11)
  97. Mus caroli tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 6)
  98. Mus musculus castaneus tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 6)
  99. Mus musculus domesticus tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 7)
  100. Mus musculus musculus tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 8)
  101. Mus musculus tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 9)
  102. Mus pahari tRNA-Glu (CTC) (tRNA-Glu-CTC-2 1 to 6)
  103. Mus spretus tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 6)
  104. Mustela putorius furo tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 5)
  105. Myotis brandtii tRNA
  106. Myotis davidii tRNA
  107. Myotis lucifugus tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 6)
  108. Neotoma lepida (desert woodrat) tRNA
  109. Nestor notabilis tRNA
  110. Nipponia nippon (crested ibis) tRNA
  111. Nomascus leucogenys tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 6)
  112. Notamacropus eugenii tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 6)
  113. Nothobranchius furzeri tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 5)
  114. Ochotona princeps tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 7)
  115. Ophiophagus hannah (king cobra) tRNA
  116. Opisthocomus hoazin tRNA
  117. Oreochromis niloticus tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 13)
  118. Ornithorhynchus anatinus tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 12)
  119. Oryctolagus cuniculus tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 15)
  120. Oryzias latipes tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 17)
  121. Otolemur garnettii tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 7)
  122. Ovis aries tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 5)
  123. Pangasianodon gigas tRNA-Glu
  124. Pangasianodon hypophthalmus tRNA-Glu
  125. Pangasius djambal tRNA-Glu
  126. Pan troglodytes tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 3, tRNA-Glu-CTC-1-6)
  127. Papio anubis tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 8)
  128. Patagioenas fasciata monilis tRNA
  129. Pelecanus crispus tRNA
  130. Pelobates cultripes tRNA.Glu
  131. Pelodiscus sinensis tRNA
  132. Perca flavescens tRNA-Glu
  133. Perca fluviatilis (European perch) tRNA-Glu
  134. Petromyzon marinus tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 8)
  135. Phaethon lepturus tRNA
  136. Phalacrocorax carbo (great cormorant) tRNA
  137. Phoenicopterus ruber ruber tRNA
  138. Dryobates pubescens tRNA
  139. Plasmodium ovale wallikeri tRNA
  140. Pleuronectes platessa (European plaice) tRNA-Glu
  141. Podarcis lilfordi tRNA.Glu
  142. Podiceps cristatus (great crested grebe) tRNA
  143. Poecilia formosa tRNA
  144. Pongo abelii tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 5)
  145. Procavia capensis tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 5)
  146. Pterocles gutturalis tRNA
  147. Pteropus alecto (black flying fox) tRNA
  148. Pygoscelis adeliae tRNA
  149. Rattus norvegicus tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 12)
  150. Saimiri boliviensis boliviensis tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 4)
  151. Salmo salar (Atlantic salmon) tRNA
  152. Sarcophilus harrisii tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 9)
  153. Scleropages formosus tRNA
  154. Sorex araneus tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 10)
  155. Sphaerodactylus townsendi tRNA-Glu
  156. Struthio camelus australis tRNA
  157. Sus scrofa tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 11)
  158. Taeniopygia guttata tRNA-Glu (CTC) (tRNA-Glu-CTC-1-1, tRNA-Glu-CTC-1-2)
  159. Takifugu rubripes tRNA-Glu (CTC) (tRNA-Glu-CTC-3 1 to 7)
  160. Tauraco erythrolophus tRNA
  161. Tetraodon nigroviridis tRNA
  162. Tinamus guttatus tRNA
  163. Trichechus manatus latirostris tRNA-Glu (CTC) (tRNA-Glu-CTC-2-1)
  164. Tupaia chinensis (Chinese tree shrew) tRNA
  165. Tursiops truncatus tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 4)
  166. Vicugna pacos tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 5)
  167. Xenopus laevis tRNA
  168. Xenopus tropicalis tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 41)
  169. Xiphophorus maculatus tRNA
2D structure