v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 538 (LINC00538) URS00004ECF3F_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC00538: LINC00538, also known as YIYA, is a long non-coding RNA (lncRNA) that has been implicated in various biological processes and diseases, including cancer. It has been shown to be associated with cyclin-dependent kinase 6 (CDK6) and is involved in the regulation of glucose utilization and glycolysis [PMC7896749] [PMC7381111] [PMC7573295] [PMC7053319]. In breast cancer, LINC00538 expression is correlated with CDK6 expression and unfavorable survival outcomes [PMC7381111]. Additionally, LINC00538 promotes glycolysis, cell proliferation, and tumor growth in breast cancer through CDK6-dependent phosphorylation of fructose bisphosphatase PFK2 (PFKFB3) [PMC9563138]. In osteosarcoma patients, LINC00538 is one of the lncRNA prognostic genes associated with prognostic significance [PMC9377863]. It has also been found to be positively correlated with dendritic cells resting but negatively linked to dendritic cells activated in osteosarcoma patients [PMC9377863]. Furthermore, LINC00538 deletion inhibits tumor growth and invasion in human breast cancer both in vitro and in a mouse xenograft model [PMC8199187]. Overall, LINC00538 plays a role in various biological processes and diseases through its interactions with CDK6 and its involvement in glucose utilization and glycolysis.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CAUCACUUCUCAUCUAGAUUCCCAUUUUGGCUUUGUCAUCUUUCUCCCCACUACAUUCCAGCUAUGUAGUCCUUCAUAUAGUUUCUAGAACGUGCCAAGAUUUCUCUUCUAGAUCUUUGCAUUUGAAAUUCCCUUUGCUUAUAAUGCUCUUGCCUAGCUCUUCAUAUAUCUGGCUUGAGGGCAUCUCUUAAGAGAGGACUUCGACUUCACCAAUCUGAAACAGCACCAUGUCACCCCCCACCCACCCCACCAACCCUUAGACUUUCUAGCACACCAAUUUCUUUAUUACCUUCUUAGGAUUUAUCCCAAACUGUGAUCUUAUUUUCCUUGUUGCUCUCUCCCAGUAAAUUGUAAGUUCUGAGAGGGUGGACUCACAUCUUUCUUGUUCACCAGUAUACCUCCAGGAUCCAGCAAAGUGCCUUGCACAUAAUAGGUACUUACUGAGCAUGAGCAUGUGUAGAAGGAAGGAAUGUUACCCUUACAAAUUUAAAUCUAGGGUCAUGUCUUUUUCAUUUUCUAUUCAUCCCAAUACAGUUCUUUGCAAAUACUAGUAUAAAUGUCUUCUCAGGUGAAUUGCACUGACUUCCCUCAAUGCUUUGCAAUUUGCAAGCUGCCUUACCUUUCUCAAAUCAGCUUUUCUGAUCUCACUACAUAUAUUCUCCAAUCUUUUCCUCCCAUAGCUCAUCUAUAUCCUAGGCCCAAUGCCAAAUGUGUUGUUUCUCUUAGAGAUUUGUACACUGCAUAUAUAGAGCCGCAUCUAUAAGAUACCAAAUAAUAGGGUAAGUAAUUAUAGGUGCAUUCAGGCAUUUUAGGGAAGAAAAGCCAGCAGCUUAACAGAGCUGGCUAGUCAGCUCCAUCAGACAAUAGAUCAGGUAGACACGUCCAGACACAAACCCCUUGCUGCUUCCUGUACCUUCUUCUGCCUGGUAUCACUCUCUCCUCUUUGAGAGUGUUUGAGUCGGAUCCUCUCAGCCAAGUGGCAGAUGGAGAAGUUGUUUGCAAUAGAGAUGAGAAUAUUUUAUCAGACUUCCUACAAAUGGGAUCCGCUGAAUUUUAAUCUGCCAGCAAAGCACUAAUGAAAAGAGGAGGAAAAGUCUCAACAGGACAUCCUGUAAGGUCUCCUCAGGAAUCAGUGUGUUUUUGGUCAACAGUCAGUUGAUAGAUGAUAAACUUCCAAGGGCAACUCAGAGAGCCCUGAAACAGAUACUUCCCUGGUCUCUCCAGGCGUCCUGUGAAGGCCACAGGGCAGAAGGGAACCUGGGUCAGGAGUCAGGAAGUCUGUAUUCCAGACCUGGUUCUGGCCCUGACUCCCUAGGUCACCGCCUGUUGGUGAUGUCACUUUCCAGUCUCUCGGUUACUCCAUCUGUACAAUGGAAAGAAUAUAUCCUAUUCUUAGCAACUGAGUGUGAAGAUGCUUCAGAAAUGAAUAUGCCAUCCAGAGAUGAAGCAAAAAUUGUUUGUAAAACGAGUAUCUUUUGUUCUUUUCUCACUCAGACAACUCCCCAACAAGCUCUAGAUUAUAAUAGCCACUGAUAUUUAUUGAGCAGUUACUAUAUGCCAGGUAUGUGCAGAGCAAAUAUAUGUACACAAAGUAAACUUUGUUGCACAUUGCAUGAAUUGUCUCUUUUAACUGUUAUUAAACCCCAGGCAGAGAGAUAAUAAAAAGGGUACUAAGAUAUCUGGAAAUCAGCAUGUCUUAGUAACAGAUAGGCAAAAGUUUUCCUAUUUAAGUGUUGCCUAGGGGCUGACCAGCAGAUGCCUCUGGAAACCAAGGGUCAUGGCAGGAAGGGUCAUAUGCCUCAGGAAAUCUUCACAGGCAGAUUGAAAUAGGGAGCCACGCAGCCACGCUCAGAAGCACAUUGCUGCCACCUCUGAAGCACUUCUCCCUCACUUCCUCCAUCCCAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications