Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Chrysemys picta bellii tRNA-Ser (GCT) (tRNA-Ser-GCT-1-1) secondary structure diagram

Chrysemys picta bellii tRNA-Ser (GCT) (tRNA-Ser-GCT-1-1) URS000047EBB5_8478

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GACGAGGUGGCCGAGUGGUUAAGGCGAUGGACUGCUAAUCCAUUGUGCUCUGCACGCGUGGGUUCGAAUCCCACCCUCGUCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 60 other species

  1. Acanthisitta chloris tRNA
  2. Ailuropoda melanoleuca tRNA-Ser (GCT) (tRNA-Ser-GCT-1-1, tRNA-Ser-GCT-1-2)
  3. Amazona aestiva tRNA
  4. Amphimedon queenslandica (Demosponge) tRNA-Ser
  5. Anas platyrhynchos tRNA
  6. Balaenoptera acutorostrata scammoni tRNA-Ser (GCT) (tRNA-Ser-GCT-1-1)
  7. Bos taurus tRNA-Ser (GCT) (tRNA-Ser-GCT-1-1)
  8. Callipepla squamata (scaled quail) tRNA
  9. Callorhinchus milii tRNA-Ser (GCT) (tRNA-Ser-GCT-1-1, tRNA-Ser-GCT-1-2)
  10. Calypte anna tRNA
  11. Camelus ferus (Wild Bactrian camel) tRNA
  12. Cavia porcellus tRNA-Ser (GCT) (tRNA-Ser-GCT-1-1, tRNA-Ser-GCT-1-2)
  13. Ceratotherium simum simum tRNA-Ser (GCT) (tRNA-Ser-GCT-1 1 to 3)
  14. Chelonia mydas tRNA
  15. Chelydra serpentina tRNA-Ser
  16. Colinus virginianus (northern bobwhite) tRNA
  17. Corvus brachyrhynchos tRNA
  18. Cricetulus griseus tRNA-Ser (GCT) (tRNA-Ser-GCT-1-1)
  19. Cuculus canorus (common cuckoo) tRNA
  20. Dendronephthya gigantea tRNA-Ser
  21. Eptesicus nilssonii tRNA-Ser
  22. Equus caballus tRNA-Ser (GCT) (tRNA-Ser-GCT-1-1)
  23. Erinaceus europaeus tRNA-Ser (GCT) (tRNA-Ser-GCT-1-1)
  24. Felis catus tRNA-Ser (GCT) (tRNA-Ser-GCT-1 1 to 4)
  25. Ficedula albicollis tRNA
  26. Fukomys damarensis tRNA
  27. Geospiza fortis tRNA-Ser (GCT) (tRNA-Ser-GCT-1-1, tRNA-Ser-GCT-1-3, tRNA-Ser-GCT-1-4)
  28. Gigantopelta aegis (Deep sea snail) tRNA-Ser
  29. Homo sapiens tRNA-Ser (anticodon GCT) 1-1 (TRS-GCT1-1)
  30. Ictidomys tridecemlineatus tRNA-Ser (GCT) (tRNA-Ser-GCT-1-1)
  31. Lamprotornis superbus tRNA-OTHER
  32. Larimichthys crocea tRNA
  33. Loxodonta africana tRNA-Ser (GCT) (tRNA-Ser-GCT-1 1 to 5)
  34. Macaca mulatta tRNA-Ser (GCT) (tRNA-Ser-GCT-1-1)
  35. Manacus vitellinus tRNA
  36. Marmota monax (woodchuck) tRNA.Ser
  37. Megalops atlanticus tRNA-Ser
  38. Mesocricetus auratus (golden hamster) tRNA
  39. Microcebus murinus tRNA-Ser (GCT) (tRNA-Ser-GCT-1-1, tRNA-Ser-GCT-1-2)
  40. Myotis brandtii tRNA
  41. Myotis davidii tRNA
  42. Neotoma lepida (desert woodrat) tRNA
  43. Nomascus leucogenys tRNA-Ser (GCT) (tRNA-Ser-GCT-1-1)
  44. Ochotona princeps tRNA-Ser (GCT) (tRNA-Ser-GCT-1 1 to 3)
  45. Ophiophagus hannah tRNA
  46. Ornithorhynchus anatinus tRNA-Ser (GCT) (tRNA-Ser-GCT-1-1)
  47. Oryctolagus cuniculus tRNA-Ser (GCT) (tRNA-Ser-GCT-1 1 to 5)
  48. Ovis aries tRNA-Ser (GCT) (tRNA-Ser-GCT-1-1)
  49. Podarcis lilfordi tRNA.Ser
  50. Procavia capensis tRNA-Ser (GCT) (tRNA-Ser-GCT-2-1)
  51. Pteropus alecto tRNA
  52. Rattus norvegicus tRNA-Ser (GCT) (tRNA-Ser-GCT-1-1)
  53. Sphaerodactylus townsendi tRNA-Ser
  54. Struthio camelus australis tRNA
  55. Sus scrofa tRNA-Ser (GCT) (tRNA-Ser-GCT-1 1 to 4)
  56. Taeniopygia guttata tRNA-Ser (GCT) (tRNA-Ser-GCT-1 1 to 3)
  57. Tinamus guttatus tRNA
  58. Tupaia chinensis (Chinese tree shrew) tRNA
  59. Tursiops truncatus tRNA-Ser (GCT) (tRNA-Ser-GCT-1-1)
  60. Vicugna pacos tRNA-Ser (GCT) (tRNA-Ser-GCT-1-1)
2D structure