v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Tupaia chinensis (Chinese tree shrew) tRNA secondary structure diagram

Tupaia chinensis (Chinese tree shrew) tRNA URS000047EBB5_246437

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GACGAGGUGGCCGAGUGGUUAAGGCGAUGGACUGCUAAUCCAUUGUGCUCUGCACGCGUGGGUUCGAAUCCCACCCUCGUCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 60 other species

  1. Acanthisitta chloris tRNA
  2. Ailuropoda melanoleuca tRNA-Ser (GCT) (tRNA-Ser-GCT-1-1, tRNA-Ser-GCT-1-2)
  3. Amazona aestiva tRNA
  4. Amphimedon queenslandica (Demosponge) tRNA-Ser
  5. Anas platyrhynchos tRNA
  6. Balaenoptera acutorostrata scammoni tRNA-Ser (GCT) (tRNA-Ser-GCT-1-1)
  7. Bos taurus tRNA-Ser (GCT) (tRNA-Ser-GCT-1-1)
  8. Callipepla squamata (scaled quail) tRNA
  9. Callorhinchus milii tRNA-Ser (GCT) (tRNA-Ser-GCT-1-1, tRNA-Ser-GCT-1-2)
  10. Calypte anna tRNA
  11. Camelus ferus (Wild Bactrian camel) tRNA
  12. Cavia porcellus tRNA-Ser (GCT) (tRNA-Ser-GCT-1-1, tRNA-Ser-GCT-1-2)
  13. Ceratotherium simum simum tRNA-Ser (GCT) (tRNA-Ser-GCT-1 1 to 3)
  14. Chelonia mydas tRNA
  15. Chelydra serpentina tRNA-Ser
  16. Chrysemys picta bellii tRNA-Ser (GCT) (tRNA-Ser-GCT-1-1)
  17. Colinus virginianus (northern bobwhite) tRNA
  18. Corvus brachyrhynchos tRNA
  19. Cricetulus griseus tRNA-Ser (GCT) (tRNA-Ser-GCT-1-1)
  20. Cuculus canorus (common cuckoo) tRNA
  21. Dendronephthya gigantea tRNA-Ser
  22. Eptesicus nilssonii tRNA-Ser
  23. Equus caballus tRNA-Ser (GCT) (tRNA-Ser-GCT-1-1)
  24. Erinaceus europaeus tRNA-Ser (GCT) (tRNA-Ser-GCT-1-1)
  25. Felis catus tRNA-Ser (GCT) (tRNA-Ser-GCT-1 1 to 4)
  26. Ficedula albicollis tRNA
  27. Fukomys damarensis tRNA
  28. Geospiza fortis tRNA-Ser (GCT) (tRNA-Ser-GCT-1-1, tRNA-Ser-GCT-1-3, tRNA-Ser-GCT-1-4)
  29. Gigantopelta aegis (Deep sea snail) tRNA-Ser
  30. Homo sapiens tRNA-Ser (anticodon GCT) 1-1 (TRS-GCT1-1)
  31. Ictidomys tridecemlineatus tRNA-Ser (GCT) (tRNA-Ser-GCT-1-1)
  32. Lamprotornis superbus tRNA-OTHER
  33. Larimichthys crocea tRNA
  34. Loxodonta africana tRNA-Ser (GCT) (tRNA-Ser-GCT-1 1 to 5)
  35. Macaca mulatta tRNA-Ser (GCT) (tRNA-Ser-GCT-1-1)
  36. Manacus vitellinus tRNA
  37. Marmota monax (woodchuck) tRNA.Ser
  38. Megalops atlanticus tRNA-Ser
  39. Mesocricetus auratus (golden hamster) tRNA
  40. Microcebus murinus tRNA-Ser (GCT) (tRNA-Ser-GCT-1-1, tRNA-Ser-GCT-1-2)
  41. Myotis brandtii tRNA
  42. Myotis davidii tRNA
  43. Neotoma lepida (desert woodrat) tRNA
  44. Nomascus leucogenys tRNA-Ser (GCT) (tRNA-Ser-GCT-1-1)
  45. Ochotona princeps tRNA-Ser (GCT) (tRNA-Ser-GCT-1 1 to 3)
  46. Ophiophagus hannah tRNA
  47. Ornithorhynchus anatinus tRNA-Ser (GCT) (tRNA-Ser-GCT-1-1)
  48. Oryctolagus cuniculus tRNA-Ser (GCT) (tRNA-Ser-GCT-1 1 to 5)
  49. Ovis aries tRNA-Ser (GCT) (tRNA-Ser-GCT-1-1)
  50. Podarcis lilfordi tRNA.Ser
  51. Procavia capensis tRNA-Ser (GCT) (tRNA-Ser-GCT-2-1)
  52. Pteropus alecto tRNA
  53. Rattus norvegicus tRNA-Ser (GCT) (tRNA-Ser-GCT-1-1)
  54. Sphaerodactylus townsendi tRNA-Ser
  55. Struthio camelus australis tRNA
  56. Sus scrofa tRNA-Ser (GCT) (tRNA-Ser-GCT-1 1 to 4)
  57. Taeniopygia guttata tRNA-Ser (GCT) (tRNA-Ser-GCT-1 1 to 3)
  58. Tinamus guttatus tRNA
  59. Tursiops truncatus tRNA-Ser (GCT) (tRNA-Ser-GCT-1-1)
  60. Vicugna pacos tRNA-Ser (GCT) (tRNA-Ser-GCT-1-1)
 2D structure Publications