Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-miR-10b URS000046820B_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-mir-10b: Ssc-mir-10b is a microRNA that showed opposite expression patterns compared to other miRNAs assayed by RT-qPCR and Solexa sequencing, being expressed at higher levels in the skeletal muscle at D100 than at E90 [PMC4423774]. In the study, three miRNAs were analyzed, including ssc-mir-10b, ssc-miR-9-1, and ssc-miR-122-5p [PMC9651005]. These miRNAs belonged to different clusters and showed differentially expression patterns [PMC9651005]. Ssc-miR-9-1 was part of Cluster 2 SEM, ssc-mir-10b belonged to Cluster 1 SEM, and ssc-miR-122-5p was associated with Cluster 4 SEM [PMC9651005]. The expression patterns of these miRNAs were consistent with the Solexa sequencing results except for ssc-mir-10b [PMC4423774]. The findings suggest that while other miRNAs exhibited similar expression patterns across developmental stages, ssc-mir-10b displayed a distinct pattern in skeletal muscle development [PMC4423774]. These results highlight the importance of considering individual miRNA expression profiles in understanding their roles in skeletal muscle development.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UACCCUGUAGAACCGAAUUUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 56 other species

  1. Alligator mississippiensis ami-miR-10b-5p
  2. Anolis carolinensis aca-miR-10b-5p
  3. Bos taurus Bta-Mir-10-P1b-v1_5p (mature (guide))
  4. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-10b
  5. Callorhinchus milii eshark_mir-10_3
  6. Canis lupus familiaris (dog) Cfa-Mir-10-P1b-v1_5p (mature (guide))
  7. Capra hircus chi-miR-10b-5p
  8. Cavia porcellus Cpo-Mir-10-P1b-v1_5p (mature (guide))
  9. Cervus elaphus (red deer) cel-miR-10b
  10. Chrysemys picta bellii Cpi-Mir-10-P1b-v1_5p (mature (guide))
  11. Chrysemys picta cpi-miR-10b-5p
  12. Columba livia (rock pigeon) cli-miR-10b-5p
  13. Cricetulus griseus cgr-miR-10b-5p
  14. Cyprinus carpio ccr-miR-10b
  15. Danio rerio (zebrafish) Dre-Mir-10-P1b1-v1_5p (mature (guide))
  16. Dasypus novemcinctus Dno-Mir-10-P1b-v1_5p (mature (guide))
  17. Daubentonia madagascariensis dma-miR-10
  18. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-10-P1b-v1_5p (mature (guide))
  19. Gadus morhua (Atlantic cod) gmo-miR-10a-5p
  20. Gallus gallus (chicken) gga-miR-10b-5p
  21. Gorilla gorilla gorilla ggo-miR-10b (MIR10B)
  22. Gorilla gorilla (western gorilla) ggo-miR-10b
  23. Haplochromis burtoni abu-miR-10a
  24. Homo sapiens Hsa-Mir-10-P1b-v1_5p (mature (guide))
  25. Ictalurus punctatus (channel catfish) ipu-miR-10b
  26. Latimeria chalumnae Lch-Mir-10-P1b_5p (mature (guide))
  27. Lepisosteus oculatus (spotted gar) Loc-Mir-10-P1b-v1_5p (mature (guide))
  28. Macaca mulatta Mml-Mir-10-P1b-v1_5p (mature (guide))
  29. Macaca nemestrina (pig-tailed macaque) mne-miR-10b
  30. Maylandia zebra mze-miR-10a
  31. Microcebus murinus mmr-miR-10
  32. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-10-P1b-v1_5p (mature (guide))
  33. Monopterus albus Mal-Mir-10-P1b1-v1_5p (mature (guide))
  34. Mus musculus Mmu-Mir-10-P1b-v1_5p (mature (guide))
  35. Neolamprologus brichardi (lyretail cichlid) nbr-miR-10a
  36. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-10b
  37. Oreochromis niloticus (Nile tilapia) oni-miR-10a
  38. Ornithorhynchus anatinus oan-miR-10b-5p
  39. Oryctolagus cuniculus (rabbit) Ocu-Mir-10-P1b-v1_5p (mature (guide))
  40. Oryzias latipes ola-miR-10b
  41. Otolemur garnettii (small-eared galago) oga-miR-10
  42. Ovis aries (sheep) miscellaneous RNA
  43. Pan paniscus (pygmy chimpanzee) ppa-miR-10b
  44. Papio hamadryas pha-miR-10b
  45. Pteropus alecto pal-miR-10b-5p
  46. Pundamilia nyererei pny-miR-10a
  47. Python bivittatus pbv-miR-10b-5p
  48. Rattus norvegicus (Norway rat) Rno-Mir-10-P1b-v1_5p (mature (guide))
  49. Saimiri boliviensis boliviensis sbo-miR-10b
  50. Salmo salar (Atlantic salmon) ssa-miR-10b-5p
  51. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-10-P1b-v1_5p (mature (guide))
  52. Sphenodon punctatus (tuatara) Spt-Mir-10-P1b_5p (mature (guide))
  53. Taeniopygia guttata tgu-miR-10a-5p
  54. Tetraodon nigroviridis (spotted green pufferfish) Tni-Mir-10-P1b1-v1_5p (mature (guide))
  55. Xenopus laevis (African clawed frog) xla-miR-10b-5p
  56. Xenopus tropicalis (tropical clawed frog) xtr-miR-10b
Publications