Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) gga-miR-10b-5p URS000046820B_9031

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

gga-mir-10b: gga-mir-10b is a microRNA that has been studied in various contexts. It has been found to exhibit putative epigenetic silencing in a resistant line of breast cancer [PMC4404578]. Additionally, gga-mir-10b has been associated with differential chromatin marks and may contribute to increased susceptibility to Marek's disease in chickens [PMC4404578]. In the context of fat deposition, the expression level of gga-mir-10b has been found to increase significantly in the breast muscle of chickens after sexual maturity [PMC8002044]. It is one of the most abundant microRNAs, along with gga-miR-10a, and represents a large proportion of total reads in libraries [PMC5520360]. The upstream region of gga-mir-10b has been studied and its promoter-like elements have been predicted using bioinformatics tools [PMC6409792]. In dwarf chickens, gga-mir-10b is significantly upregulated in adipose tissue, suggesting a role in reduced adipogenesis compared to typical chickens [PMC7936154]. It is also one of the most abundant microRNAs detected in chicken somites [PMC3107184]. In MDV-infected cells, gga-mir-10b is increased compared to uninfected cells [PMC3472249]. Additionally, it has been found to be upregulated during MDV infection in the spleen [PMC7564597]. In vesicles derived from chicken cells, gga-mir-10b appears as one of the least abundant microRNAs detected [PMC7734234].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UACCCUGUAGAACCGAAUUUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 56 other species

  1. Alligator mississippiensis ami-miR-10b-5p
  2. Anolis carolinensis aca-miR-10b-5p
  3. Bos taurus Bta-Mir-10-P1b-v1_5p (mature (guide))
  4. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-10b
  5. Callorhinchus milii eshark_mir-10_3
  6. Canis lupus familiaris (dog) Cfa-Mir-10-P1b-v1_5p (mature (guide))
  7. Capra hircus chi-miR-10b-5p
  8. Cavia porcellus Cpo-Mir-10-P1b-v1_5p (mature (guide))
  9. Cervus elaphus (red deer) cel-miR-10b
  10. Chrysemys picta bellii Cpi-Mir-10-P1b-v1_5p (mature (guide))
  11. Chrysemys picta cpi-miR-10b-5p
  12. Columba livia (rock pigeon) cli-miR-10b-5p
  13. Cricetulus griseus cgr-miR-10b-5p
  14. Cyprinus carpio ccr-miR-10b
  15. Danio rerio (zebrafish) Dre-Mir-10-P1b1-v1_5p (mature (guide))
  16. Dasypus novemcinctus Dno-Mir-10-P1b-v1_5p (mature (guide))
  17. Daubentonia madagascariensis dma-miR-10
  18. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-10-P1b-v1_5p (mature (guide))
  19. Gadus morhua (Atlantic cod) gmo-miR-10a-5p
  20. Gorilla gorilla gorilla ggo-miR-10b (MIR10B)
  21. Gorilla gorilla (western gorilla) ggo-miR-10b
  22. Haplochromis burtoni abu-miR-10a
  23. Homo sapiens Hsa-Mir-10-P1b-v1_5p (mature (guide))
  24. Ictalurus punctatus (channel catfish) ipu-miR-10b
  25. Latimeria chalumnae Lch-Mir-10-P1b_5p (mature (guide))
  26. Lepisosteus oculatus (spotted gar) Loc-Mir-10-P1b-v1_5p (mature (guide))
  27. Macaca mulatta Mml-Mir-10-P1b-v1_5p (mature (guide))
  28. Macaca nemestrina (pig-tailed macaque) mne-miR-10b
  29. Maylandia zebra mze-miR-10a
  30. Microcebus murinus mmr-miR-10
  31. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-10-P1b-v1_5p (mature (guide))
  32. Monopterus albus Mal-Mir-10-P1b1-v1_5p (mature (guide))
  33. Mus musculus Mmu-Mir-10-P1b-v1_5p (mature (guide))
  34. Neolamprologus brichardi (lyretail cichlid) nbr-miR-10a
  35. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-10b
  36. Oreochromis niloticus (Nile tilapia) oni-miR-10a
  37. Ornithorhynchus anatinus oan-miR-10b-5p
  38. Oryctolagus cuniculus (rabbit) Ocu-Mir-10-P1b-v1_5p (mature (guide))
  39. Oryzias latipes ola-miR-10b
  40. Otolemur garnettii (small-eared galago) oga-miR-10
  41. Ovis aries (sheep) miscellaneous RNA
  42. Pan paniscus (pygmy chimpanzee) ppa-miR-10b
  43. Papio hamadryas pha-miR-10b
  44. Pteropus alecto pal-miR-10b-5p
  45. Pundamilia nyererei pny-miR-10a
  46. Python bivittatus pbv-miR-10b-5p
  47. Rattus norvegicus (Norway rat) Rno-Mir-10-P1b-v1_5p (mature (guide))
  48. Saimiri boliviensis boliviensis sbo-miR-10b
  49. Salmo salar (Atlantic salmon) ssa-miR-10b-5p
  50. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-10-P1b-v1_5p (mature (guide))
  51. Sphenodon punctatus (tuatara) Spt-Mir-10-P1b_5p (mature (guide))
  52. Sus scrofa ssc-miR-10b
  53. Taeniopygia guttata tgu-miR-10a-5p
  54. Tetraodon nigroviridis (spotted green pufferfish) Tni-Mir-10-P1b1-v1_5p (mature (guide))
  55. Xenopus laevis (African clawed frog) xla-miR-10b-5p
  56. Xenopus tropicalis (tropical clawed frog) xtr-miR-10b
Publications