v27

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) tRNA-Cys (anticodon GCA) 8-1 (TRC-GCA8-1) secondary structure diagram

Homo sapiens (human) tRNA-Cys (anticodon GCA) 8-1 (TRC-GCA8-1) URS000042C3BF_9606

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GGGGGUAUAGCUCAGGGGUAGAGCAUUUGACUGCAGAUCAAGAGGUCCCCGGUUCAAAUCCGGGUGCCCCCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 233 other species

  1. Acinonyx jubatus (cheetah) tRNA
  2. Aegotheles bennettii tRNA
  3. Ailuropoda melanoleuca tRNA-Cys (GCA) (tRNA-Cys-GCA-4 1 to 5)
  4. Amazona aestiva (blue-fronted amazon) tRNA
  5. Amazona collaria (yellow-billed parrot) tRNA
  6. Amazona guildingii tRNA
  7. Anas platyrhynchos platyrhynchos (common mallard) tRNA
  8. Anas platyrhynchos tRNA
  9. Anas zonorhyncha tRNA
  10. Anhinga rufa (African darter) tRNA
  11. Anseranas semipalmata (magpie goose) tRNA
  12. Anser brachyrhynchus (pink-footed goose) tRNA
  13. Anser cygnoides (Chinese goose) tRNA
  14. Anthoscopus minutus tRNA
  15. Aotus nancymaae (Ma's night monkey) tRNA
  16. Apaloderma vittatum tRNA
  17. Asarcornis scutulata tRNA
  18. Athene cunicularia tRNA
  19. Atractosteus spatula (alligator gar) tRNA
  20. Aythya fuligula (tufted duck) tRNA
  21. Balaenoptera acutorostrata scammoni tRNA-Cys (GCA) (tRNA-Cys-GCA-3-1, tRNA-Cys-GCA-3-2)
  22. Balaenoptera musculus (Blue whale) tRNA
  23. Balaenoptera physalus (Fin whale) tRNA
  24. Bambusicola thoracicus Bambusicola thoracica (Chinese bamboo-partridge) tRNA
  25. Baryphthengus martii tRNA
  26. Bison bison bison (north american plains bison) tRNA
  27. Bos grunniens (domestic yak) tRNA
  28. Bos mutus Bos grunniens mutus tRNA
  29. Bos indicus tRNA
  30. Bos indicus x Bos taurus (hybrid cattle) tRNA
  31. Bos taurus tRNA-Cys (GCA) (tRNA-Cys-GCA-4 1 to 6)
  32. Brachypteracias leptosomus (short-legged ground-roller) tRNA
  33. Bubo bubo tRNA
  34. Bucco capensis (collared puffbird) tRNA
  35. Cairina moschata domestica (muscovy duck (domestic type)) tRNA
  36. Calcarius ornatus tRNA
  37. Callipepla squamata tRNA
  38. Callithrix jacchus tRNA-Cys (GCA) (tRNA-Cys-GCA-7 1 to 3)
  39. Callorhinus ursinus (northern fur seal) tRNA
  40. Camarhynchus parvulus tRNA
  41. Camelus bactrianus (Bactrian camel) tRNA
  42. Camelus dromedarius (Arabian camel) tRNA
  43. Camelus ferus (Wild Bactrian camel) tRNA
  44. Campylorhamphus procurvoides tRNA
  45. Canis lupus dingo (dingo) tRNA
  46. Canis lupus familiaris tRNA-Cys (GCA) (tRNA-Cys-GCA-4 1 to 5)
  47. Capra hircus (goat) tRNA
  48. Antrostomus carolinensis tRNA
  49. Cardinalis cardinalis tRNA
  50. Carlito syrichta tRNA-Cys (GCA) (tRNA-Cys-GCA-2 1 to 3)
  51. Castor canadensis (American beaver) tRNA
  52. Catagonus wagneri (Chacoan peccary) tRNA
  53. Cavia porcellus tRNA-Cys (GCA) (tRNA-Cys-GCA-3-1, tRNA-Cys-GCA-3-2)
  54. Sapajus apella Cebus apella (Tufted capuchin) tRNA
  55. Cebus imitator (Panamanian white-faced capuchin) tRNA
  56. Ceratotherium simum simum tRNA-Cys (GCA) (tRNA-Cys-GCA-4-1, tRNA-Cys-GCA-4-2)
  57. Cercocebus atys (sooty mangabey) tRNA
  58. Certhia brachydactyla tRNA
  59. Cervus elaphus hippelaphus tRNA
  60. Cervus hanglu yarkandensis Cervus elaphus yarkandensis tRNA
  61. Charadrius vociferus tRNA
  62. Chinchilla lanigera tRNA
  63. Chionis minor (black-faced sheathbill) tRNA
  64. Chlorocebus sabaeus tRNA-Cys (GCA) (tRNA-Cys-GCA-4 1 to 3)
  65. Choloepus hoffmanni tRNA-Cys (GCA) (tRNA-Cys-GCA-3-1)
  66. Chordeiles acutipennis (lesser nighthawk) tRNA
  67. Chrysolophus pictus (golden pheasant) tRNA
  68. Ciccaba nigrolineata tRNA
  69. Cisticola juncidis tRNA
  70. Colinus virginianus tRNA
  71. Colobus angolensis palliatus tRNA
  72. Corvus brachyrhynchos (American crow) tRNA
  73. Coturnix japonica (Japanese quail) tRNA
  74. Gymnorhina tibicen Cracticus tibicen (Australian magpie) tRNA
  75. Cricetulus griseus tRNA-Cys (GCA) (tRNA-Cys-GCA-4-1)
  76. Crocuta crocuta (spotted hyena) tRNA
  77. Crypturellus soui tRNA
  78. Crypturellus undulatus tRNA
  79. Dasypus novemcinctus tRNA-Cys (GCA) (tRNA-Cys-GCA-4-1, tRNA-Cys-GCA-4-2)
  80. Delphinapterus leucas (beluga whale) tRNA
  81. Setophaga kirtlandii Dendroica kirtlandii (Kirtland's warbler) tRNA
  82. Diceros bicornis minor tRNA
  83. Dipodomys ordii tRNA-Cys (GCA) (tRNA-Cys-GCA-4-1, tRNA-Cys-GCA-4-2)
  84. Enhydra lutris kenyoni tRNA
  85. Eolophus roseicapilla Eolophus roseicapillus (Galah) tRNA
  86. Cnephaeus nilssonii Eptesicus nilssoni (northern bat) tRNA
  87. Equus asinus (ass) tRNA
  88. Equus caballus tRNA-Cys (GCA) (tRNA-Cys-GCA-3 1 to 3)
  89. Eschrichtius robustus (grey whale) tRNA
  90. Eubucco bourcierii (red-headed barbet) tRNA
  91. Eudromia elegans (elegant crested-tinamou) tRNA
  92. Eulacestoma nigropectus (wattled ploughbill) tRNA
  93. Felis catus tRNA-Cys (GCA) (tRNA-Cys-GCA-4 1 to 7)
  94. Fregetta grallaria tRNA
  95. Fukomys damarensis (Damara mole-rat) tRNA
  96. Furnarius figulus tRNA
  97. Galbula dea tRNA
  98. Galemys pyrenaicus tRNA
  99. Gallus gallus tRNA-Cys (GCA) (tRNA-Cys-GCA-3-1, tRNA-Cys-GCA-3-2)
  100. Geospiza fortis tRNA-Cys (GCA) (tRNA-Cys-GCA-4-1)
  101. Glaucidium brasilianum (ferruginous pygmy-owl) tRNA
  102. Gorilla gorilla gorilla tRNA-Cys (GCA) (tRNA-Cys-GCA-7-1)
  103. Grallaria varia (variegated antpitta) tRNA
  104. Gulo gulo (wolverine) tRNA
  105. Halcyon senegalensis tRNA
  106. Heterocephalus glaber tRNA-Cys (GCA) (tRNA-Cys-GCA-3-1)
  107. Hipposideros armiger tRNA
  108. Inia geoffrensis tRNA-Cys
  109. Irena cyanogastra Irena cyanogaster tRNA
  110. Jaculus jaculus (lesser Egyptian jerboa) tRNA
  111. Lepisosteus oculatus (spotted gar) tRNA
  112. Leptonychotes weddellii (Weddell seal) tRNA
  113. Lipotes vexillifer (Yangtze River dolphin) tRNA
  114. Loxia curvirostra tRNA
  115. Loxia leucoptera tRNA
  116. Loxodonta africana tRNA-Cys (GCA) (tRNA-Cys-GCA-4-1, tRNA-Cys-GCA-4-2)
  117. Lynx canadensis (Canada lynx) tRNA
  118. Lynx pardinus (Spanish lynx) tRNA
  119. Macaca fascicularis (crab-eating macaque) tRNA
  120. Macaca mulatta tRNA-Cys (GCA) (tRNA-Cys-GCA-8-1, tRNA-Cys-GCA-8-2)
  121. Macaca nemestrina (pig-tailed macaque) tRNA
  122. Mandrillus leucophaeus (drill) tRNA
  123. Meleagris gallopavo tRNA-Cys (GCA) (tRNA-Cys-GCA-2-1, tRNA-Cys-GCA-2-2)
  124. Melopsittacus undulatus tRNA-Cys (GCA) (tRNA-Cys-GCA-3-1)
  125. Melospiza melodia (song sparrow) tRNA
  126. Merops nubicus tRNA
  127. Mesocricetus auratus (golden hamster) tRNA
  128. Microcebus murinus tRNA-Cys (GCA) (tRNA-Cys-GCA-3-1)
  129. Molossus molossus (Pallas's mastiff bat) tRNA
  130. Molothrus ater tRNA
  131. Neomonachus schauinslandi Monachus schauinslandi (Hawaiian monk seal) tRNA
  132. Monodon monoceros (narwhal) tRNA
  133. Moschus moschiferus (Siberian musk deer) tRNA
  134. Motacilla alba tRNA
  135. Muntiacus reevesi (Chinese muntjac) tRNA
  136. Mus caroli tRNA-Cys (GCA) (tRNA-Cys-GCA-4-1)
  137. Mus musculus castaneus tRNA-Cys (GCA) (tRNA-Cys-GCA-4-1)
  138. Mus musculus domesticus tRNA-Cys (GCA) (tRNA-Cys-GCA-4-1)
  139. Mus musculus musculus tRNA-Cys (GCA) (tRNA-Cys-GCA-4-1)
  140. Mus musculus tRNA-Cys (GCA) (tRNA-Cys-GCA-4-1, tRNA-Cys-GCA-7-1)
  141. Mus spicilegus (steppe mouse) tRNA
  142. Mus spretus tRNA-Cys (GCA) (tRNA-Cys-GCA-4-1)
  143. Mustela putorius furo tRNA-Cys (GCA) (tRNA-Cys-GCA-4 1 to 4)
  144. Myotis brandtii tRNA
  145. Myotis davidii tRNA
  146. Myotis lucifugus tRNA-Cys (GCA) (tRNA-Cys-GCA-4 1 to 9)
  147. Myotis myotis tRNA
  148. Nannospalax galili (Upper Galilee mountains blind mole rat) tRNA
  149. Neophocaena asiaeorientalis asiaeorientalis (yangtze finless porpoise) tRNA
  150. Neotoma lepida (desert woodrat) tRNA
  151. Neogale vison Neovison vison tRNA
  152. Nesospiza acunhae tRNA
  153. Nestor notabilis tRNA
  154. Nomascus leucogenys tRNA-Cys (GCA) (tRNA-Cys-GCA-8-1)
  155. Nothoprocta ornata tRNA
  156. Nothoprocta perdicaria tRNA
  157. Nyctereutes procyonoides (raccoon dog) tRNA
  158. Oceanites oceanicus tRNA
  159. Octodon degus (degu) tRNA
  160. Odobenus rosmarus divergens (Pacific walrus) tRNA
  161. Odocoileus virginianus texanus tRNA
  162. Odontophorus gujanensis (marbled wood quail) tRNA
  163. Origma solitaria tRNA
  164. Ornithorhynchus anatinus tRNA-Cys (GCA) (tRNA-Cys-GCA-2 1 to 5)
  165. Orycteropus afer afer tRNA
  166. Oryctolagus cuniculus tRNA-Cys (GCA) (tRNA-Cys-GCA-4-1)
  167. Otolemur garnettii tRNA-Cys (GCA) (tRNA-Cys-GCA-3-1)
  168. Otus sunia (Oriental scops-owl) tRNA
  169. Ovis aries tRNA-Cys (GCA) (tRNA-Cys-GCA-4 1 to 5)
  170. Pachycephala philippinensis tRNA
  171. Pan paniscus tRNA-Cys (GCA) (tRNA-Cys-GCA-4-1)
  172. Panthera leo (lion) tRNA
  173. Panthera tigris altaica (Amur tiger) tRNA
  174. Pan troglodytes tRNA-Cys (GCA) (tRNA-Cys-GCA-8-1)
  175. Papio anubis tRNA-Cys (GCA) (tRNA-Cys-GCA-7 1 to 4)
  176. Pardalotus punctatus (spotted pardalote) tRNA
  177. Passerina amoena tRNA
  178. Pavo cristatus (Indian peafowl) tRNA
  179. Penelope pileata tRNA
  180. Peromyscus maniculatus bairdii (prairie deer mouse) tRNA
  181. Peromyscus maniculatus sonoriensis tRNA-Cys
  182. Phasianus colchicus (Ring-necked pheasant) tRNA
  183. Pheucticus melanocephalus tRNA
  184. Phocoena sinus (vaquita) tRNA
  185. Phyllostomus discolor (pale spear-nosed bat) tRNA
  186. Physeter macrocephalus Physeter catodon (sperm whale) tRNA
  187. Piliocolobus tephrosceles (Ugandan red Colobus) tRNA
  188. Pipistrellus kuhlii (Kuhl's pipistrelle) tRNA
  189. Plecturocebus cupreus tRNA-OTHER
  190. Pluvianellus socialis (magellanic plover) tRNA
  191. Podargus strigoides (tawny frogmouth) tRNA
  192. Pongo abelii tRNA-Cys (GCA) (tRNA-Cys-GCA-6-2)
  193. Probosciger aterrimus tRNA
  194. Procavia capensis tRNA-Cys (GCA) (tRNA-Cys-GCA-4-1, tRNA-Cys-GCA-4-2)
  195. Propithecus coquereli (Coquerel's sifaka) tRNA
  196. Psilopogon haemacephalus tRNA
  197. Pteropus alecto (black flying fox) tRNA
  198. Pteropus vampyrus (large flying fox) tRNA
  199. Puma concolor (puma) tRNA
  200. Quiscalus mexicanus tRNA
  201. Rattus norvegicus tRNA-Cys (GCA) (tRNA-Cys-GCA-4-1)
  202. Rhinolophus ferrumequinum (greater horseshoe bat) tRNA
  203. Rhinopithecus bieti (Black snub-nosed monkey) tRNA
  204. Rhinopithecus roxellana (golden snub-nosed monkey) tRNA
  205. Rhinopomastus cyanomelas (common scimitar-bill) tRNA
  206. Rhinoptilus africanus (double-banded courser) tRNA
  207. Rousettus aegyptiacus (Egyptian rousette) tRNA
  208. Saimiri boliviensis boliviensis tRNA-Cys (GCA) (tRNA-Cys-GCA-6 1 to 3)
  209. Sciurus carolinensis (gray squirrel) tRNA
  210. Sciurus vulgaris (Eurasian red squirrel) tRNA
  211. Sclerurus mexicanus (tawny-throated leaftosser) tRNA
  212. Scytalopus superciliaris tRNA
  213. Serinus canaria (common canary) tRNA
  214. Sigmodon hispidus tRNA-Cys
  215. Sorex araneus tRNA-Cys (GCA) (tRNA-Cys-GCA-3-1, tRNA-Cys-GCA-3-2)
  216. Sousa chinensis (Indo-pacific humpbacked dolphin) tRNA
  217. Spizella passerina (chipping sparrow) tRNA
  218. Strix occidentalis caurina tRNA
  219. Suricata suricatta (meerkat) tRNA
  220. Sus scrofa tRNA-Cys (GCA) (tRNA-Cys-GCA-2-1, tRNA-Cys-GCA-2-2)
  221. Symphalangus syndactylus tRNA-Cys (GCA) (tRNA-Cys-GCA-4-1, tRNA-Cys-GCA-4-2)
  222. Theropithecus gelada (gelada baboon) tRNA
  223. Tinamus guttatus tRNA
  224. Tricholaema leucomelas (pied barbet) tRNA
  225. Tupaia belangeri chinensis Tupaia chinensis (Chinese tree shrew) tRNA
  226. Tursiops truncatus tRNA-Cys (GCA) (tRNA-Cys-GCA-4-1, tRNA-Cys-GCA-4-2)
  227. Ursus americanus (American black bear) tRNA
  228. Ursus maritimus (polar bear) tRNA
  229. Vicugna pacos tRNA-Cys (GCA) (tRNA-Cys-GCA-4 1 to 3)
  230. Vidua macroura tRNA
  231. Vombatus ursinus (common wombat) tRNA
  232. Vulpes vulpes (red fox) tRNA
  233. Xenopus tropicalis tRNA-Cys (GCA) (tRNA-Cys-GCA-3-1)
  234. Zonotrichia albicollis tRNA
 Relationships

Molecular Relationships

 2D structure

Loading 2D structure...

 Publications