Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Tinamus guttatus tRNA secondary structure diagram

Tinamus guttatus tRNA URS000042C3BF_94827

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGGGGUAUAGCUCAGGGGUAGAGCAUUUGACUGCAGAUCAAGAGGUCCCCGGUUCAAAUCCGGGUGCCCCCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 68 other species

  1. Ailuropoda melanoleuca tRNA-Cys (GCA) (tRNA-Cys-GCA-4 1 to 5)
  2. Amazona aestiva tRNA
  3. Anas platyrhynchos tRNA
  4. Apaloderma vittatum tRNA
  5. Balaenoptera acutorostrata scammoni tRNA-Cys (GCA) (tRNA-Cys-GCA-3-1, tRNA-Cys-GCA-3-2)
  6. Bos taurus tRNA-Cys (GCA) (tRNA-Cys-GCA-4 1 to 6)
  7. Callipepla squamata (scaled quail) tRNA
  8. Callithrix jacchus tRNA-Cys (GCA) (tRNA-Cys-GCA-7 1 to 3)
  9. Camelus ferus (Wild Bactrian camel) tRNA
  10. Canis lupus familiaris tRNA-Cys (GCA) (tRNA-Cys-GCA-4 1 to 5)
  11. Antrostomus carolinensis tRNA
  12. Carlito syrichta tRNA-Cys (GCA) (tRNA-Cys-GCA-2 1 to 3)
  13. Cavia porcellus tRNA-Cys (GCA) (tRNA-Cys-GCA-3-1, tRNA-Cys-GCA-3-2)
  14. Ceratotherium simum simum tRNA-Cys (GCA) (tRNA-Cys-GCA-4-1, tRNA-Cys-GCA-4-2)
  15. Charadrius vociferus tRNA
  16. Chlorocebus sabaeus tRNA-Cys (GCA) (tRNA-Cys-GCA-4 1 to 3)
  17. Choloepus hoffmanni tRNA-Cys (GCA) (tRNA-Cys-GCA-3-1)
  18. Colinus virginianus tRNA
  19. Cricetulus griseus tRNA-Cys (GCA) (tRNA-Cys-GCA-4-1)
  20. Dasypus novemcinctus tRNA-Cys (GCA) (tRNA-Cys-GCA-4-1, tRNA-Cys-GCA-4-2)
  21. Dipodomys ordii tRNA-Cys (GCA) (tRNA-Cys-GCA-4-1, tRNA-Cys-GCA-4-2)
  22. Equus caballus tRNA-Cys (GCA) (tRNA-Cys-GCA-3 1 to 3)
  23. Eschrichtius robustus tRNA-Cys
  24. Felis catus tRNA-Cys (GCA) (tRNA-Cys-GCA-4 1 to 7)
  25. Fukomys damarensis (Damara mole-rat) tRNA
  26. Gallus gallus tRNA-Cys (GCA) (tRNA-Cys-GCA-3-1, tRNA-Cys-GCA-3-2)
  27. Geospiza fortis tRNA-Cys (GCA) (tRNA-Cys-GCA-4-1)
  28. Gorilla gorilla gorilla tRNA-Cys (GCA) (tRNA-Cys-GCA-7-1)
  29. Heterocephalus glaber tRNA-Cys (GCA) (tRNA-Cys-GCA-3-1)
  30. Homo sapiens tRNA-Cys (anticodon GCA) 8-1 (TRC-GCA8-1)
  31. Lepisosteus oculatus tRNA
  32. Loxodonta africana tRNA-Cys (GCA) (tRNA-Cys-GCA-4-1, tRNA-Cys-GCA-4-2)
  33. Macaca mulatta tRNA-Cys (GCA) (tRNA-Cys-GCA-8-1, tRNA-Cys-GCA-8-2)
  34. Meleagris gallopavo tRNA-Cys (GCA) (tRNA-Cys-GCA-2-1, tRNA-Cys-GCA-2-2)
  35. Melopsittacus undulatus tRNA-Cys (GCA) (tRNA-Cys-GCA-3-1)
  36. Merops nubicus tRNA
  37. Mesocricetus auratus (golden hamster) tRNA
  38. Microcebus murinus tRNA-Cys (GCA) (tRNA-Cys-GCA-3-1)
  39. Mus caroli tRNA-Cys (GCA) (tRNA-Cys-GCA-4-1)
  40. Mus musculus castaneus tRNA-Cys (GCA) (tRNA-Cys-GCA-4-1)
  41. Mus musculus domesticus tRNA-Cys (GCA) (tRNA-Cys-GCA-4-1)
  42. Mus musculus musculus tRNA-Cys (GCA) (tRNA-Cys-GCA-4-1)
  43. Mus musculus tRNA-Cys (GCA) (tRNA-Cys-GCA-4-1, tRNA-Cys-GCA-7-1)
  44. Mus spretus tRNA-Cys (GCA) (tRNA-Cys-GCA-4-1)
  45. Mustela putorius furo tRNA-Cys (GCA) (tRNA-Cys-GCA-4 1 to 4)
  46. Myotis brandtii tRNA
  47. Myotis davidii tRNA
  48. Myotis lucifugus tRNA-Cys (GCA) (tRNA-Cys-GCA-4 1 to 9)
  49. Neotoma lepida tRNA
  50. Nestor notabilis tRNA
  51. Nomascus leucogenys tRNA-Cys (GCA) (tRNA-Cys-GCA-8-1)
  52. Ornithorhynchus anatinus tRNA-Cys (GCA) (tRNA-Cys-GCA-2 1 to 5)
  53. Oryctolagus cuniculus tRNA-Cys (GCA) (tRNA-Cys-GCA-4-1)
  54. Otolemur garnettii tRNA-Cys (GCA) (tRNA-Cys-GCA-3-1)
  55. Ovis aries tRNA-Cys (GCA) (tRNA-Cys-GCA-4 1 to 5)
  56. Pan troglodytes tRNA-Cys (GCA) (tRNA-Cys-GCA-8-1)
  57. Papio anubis tRNA-Cys (GCA) (tRNA-Cys-GCA-7 1 to 4)
  58. Pongo abelii tRNA-Cys (GCA) (tRNA-Cys-GCA-6-2)
  59. Procavia capensis tRNA-Cys (GCA) (tRNA-Cys-GCA-4-1, tRNA-Cys-GCA-4-2)
  60. Pteropus alecto tRNA
  61. Rattus norvegicus tRNA-Cys (GCA) (tRNA-Cys-GCA-4-1)
  62. Saimiri boliviensis boliviensis tRNA-Cys (GCA) (tRNA-Cys-GCA-6 1 to 3)
  63. Sorex araneus tRNA-Cys (GCA) (tRNA-Cys-GCA-3-1, tRNA-Cys-GCA-3-2)
  64. Sus scrofa tRNA-Cys (GCA) (tRNA-Cys-GCA-2-1, tRNA-Cys-GCA-2-2)
  65. Tupaia chinensis (Chinese tree shrew) tRNA
  66. Tursiops truncatus tRNA-Cys (GCA) (tRNA-Cys-GCA-4-1, tRNA-Cys-GCA-4-2)
  67. Vicugna pacos tRNA-Cys (GCA) (tRNA-Cys-GCA-4 1 to 3)
  68. Xenopus tropicalis tRNA-Cys (GCA) (tRNA-Cys-GCA-3-1)
2D structure Publications