Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) mitochondrially encoded tRNA-Asn (AAU/C) (MT-TN) secondary structure diagram

Homo sapiens (human) mitochondrially encoded tRNA-Asn (AAU/C) (MT-TN) URS00004206E2_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MT-TN: MT-TN is a type of tRNA gene found in the mitochondrial DNA (mtDNA) of various species, including humans and monkeys [PMC8073089]. In monkeys, two amplicons in the DNA samples align with human mtDNA tRNA genes MT-TA, MT-TN, and MT-TW [PMC8073089]. Another amplicon aligns with human mtDNA tRNA genes MT-TN and MT-C [PMC8073089]. In cynomolgus monkeys, there are 64 differences in the UAS (unassigned sequence) compared to the revised Cambridge Reference Sequence (rCRS), including insertions, single nucleotide variations (SNVs), and deletions [PMC8073089]. The expression levels of several tRNA genes, including MT-TN, are consistently down-regulated at 2 and 5 months in monkeys [PMC8522632]. A specific mutation in the MT-TN gene at position m.5690A > G has been identified [PMC4606788]. The differential expression of tRNA genes such as MT-TN and MT-TC has been validated using locus-specific pyrosequencing [PMC6311003]. In articular cartilage RNA-Seq data from monkeys, the expression of MT-TN is increased following a specific treatment and is involved in mitochondrial enzyme Complex 1 for protein synthesis [PMC9025840]. Various other tRNA genes are also present in mtDNA, such as MT-TL1, MT-TC, and many others [PMC8947152].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAGAUUGAAGCCAGUUGAUUAGGGUGCUUAGCUGUUAACUAAGUGUUUGUGGGUUUAAGUCCCAUUGGUCUAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

  1. Cloning vector pRS316-1B9 tRNA-Asn
  2. Homo heidelbergensis tRNA-Asn
  3. Homo sapiens subsp. 'Denisova' subsp. 'Denisova' (Denisova hominin) transfer RNA-Asp
  4. Plasmodium ovale wallikeri tRNA
2D structure Publications