v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Plasmodium ovale wallikeri tRNA secondary structure diagram

Plasmodium ovale wallikeri tRNA URS00004206E2_864142

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UAGAUUGAAGCCAGUUGAUUAGGGUGCUUAGCUGUUAACUAAGUGUUUGUGGGUUUAAGUCCCAUUGGUCUAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

  1. Cloning vector pRS316-1B9 tRNA-Asn
  2. Homo heidelbergensis tRNA-Asn
  3. Homo sapiens mitochondrially encoded tRNA-Asn (AAU/C) (MT-TN)
  4. Homo sapiens subsp. 'Denisova' subsp. 'Denisova' (Denisova hominin) transfer RNA-Asp
 2D structure Publications