Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-376a URS000041E11D_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-376a: Bta-mir-376a is a microRNA that plays a role in the regulation of preadipocyte proliferation and differentiation in Qinchuan beef cattle [PMC7763857]. The CCK-8 findings showed that the overexpression of bta-mir-376a inhibited the proliferation of adipocytes [PMC7763857]. The expression levels of bta-mir-376a were higher in the stomach and reticular tissues compared to other tissues [PMC7763857]. Bta-mir-376a was found to target the 3'-UTR of KLF15, a gene involved in adipogenesis, as predicted by bioinformatics tools [PMC7763857]. Dual-luciferase reporter assays confirmed KLF15 as a target gene of bta-mir-376a [PMC7763857]. Bta-mir-376a was found to be a negative regulator of adipocyte differentiation and adipogenesis signal transduction pathways [PMC7763857]. The overexpression of bta-mir-376a reduced triglyceride contents and downregulated the expression of adipogenic markers such as CEBPα, PPARγ, and FAS genes [PMC7763857]. Bta-mir-376a inhibited adipocyte proliferation by reducing S-phase cells and decreasing EdU-labeled cells [PMC7763857]. Staining with oil red O confirmed that bta-mir-376a overexpression reduced lipid droplets in bovine adipocytes [PMC7763857]. The expression levels of bta-mir-376a increased during the proliferation stage but decreased during differentiation, suggesting its role in regulating both processes simultaneously [PMC7763857]. Overall, bta-mir-376a is a negative regulator that inhibits preadipocyte proliferation and differentiation by targeting KLF15. It plays an important role in regulating bovine adipogenesis.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUCAUAGAGGAAAAUCCACGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 14 other species

  1. Callithrix jacchus cja-miR-376a-3p
  2. Canis lupus familiaris cfa-miR-376a
  3. Cavia porcellus (domestic guinea pig) cpo-miR-376a-3p
  4. Cervus elaphus cel-miR-376a
  5. Dasypus novemcinctus dno-miR-376a-3p
  6. Equus caballus (horse) eca-miR-376a
  7. Homo sapiens (human) hsa-miR-376a-3p
  8. Macaca mulatta (Rhesus monkey) mml-miR-376a-3p
  9. Oryctolagus cuniculus (rabbit) ocu-miR-376a-3p
  10. Ovis aries oar-miR-376a-3p
  11. Pan troglodytes (chimpanzee) ptr-miR-376a
  12. Pongo pygmaeus (Bornean orangutan) ppy-miR-376a
  13. Sus scrofa ssc-miR-376a-3p
  14. Tupaia chinensis (Chinese tree shrew) tch-miR-376a-3p
Publications