Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Dasypus novemcinctus (nine-banded armadillo) dno-miR-376a-3p URS000041E11D_9361

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUCAUAGAGGAAAAUCCACGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 14 other species

  1. Bos taurus bta-miR-376a
  2. Callithrix jacchus cja-miR-376a-3p
  3. Canis lupus familiaris cfa-miR-376a
  4. Cavia porcellus (domestic guinea pig) cpo-miR-376a-3p
  5. Cervus elaphus cel-miR-376a
  6. Equus caballus (horse) eca-miR-376a
  7. Homo sapiens (human) hsa-miR-376a-3p
  8. Macaca mulatta (Rhesus monkey) mml-miR-376a-3p
  9. Oryctolagus cuniculus (rabbit) ocu-miR-376a-3p
  10. Ovis aries oar-miR-376a-3p
  11. Pan troglodytes (chimpanzee) ptr-miR-376a
  12. Pongo pygmaeus (Bornean orangutan) ppy-miR-376a
  13. Sus scrofa ssc-miR-376a-3p
  14. Tupaia chinensis (Chinese tree shrew) tch-miR-376a-3p