Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Dasypus novemcinctus (nine-banded armadillo) Dno-Mir-133-P2-v2_3p (mature (guide)) URS00003EDD3D_9361

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUGGUCCCCUUCAACCAGCUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 28 other species

  1. Alligator mississippiensis Ami-Mir-133-P2-v2_3p (mature (guide))
  2. Bos taurus Bta-Mir-133-P2-v2_3p (mature (guide))
  3. Brugia malayi (agent of lymphatic filariasis) bma-miR-133
  4. Canis lupus familiaris (dog) Cfa-Mir-133-P2-v2_3p (mature (guide))
  5. Cavia porcellus (domestic guinea pig) Cpo-Mir-133-P2-v2_3p (mature (guide))
  6. Chrysemys picta bellii (western painted turtle) Cpi-Mir-133-P2-v2_3p (mature (guide))
  7. Ciona savignyi (Pacific transparent sea squirt) csa-miR-133
  8. Columba livia Cli-Mir-133-P2-v2_3p (mature (guide))
  9. Danio rerio (zebrafish) Dre-Mir-133-P2a-v2_3p (mature (guide))
  10. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-133-P2-v2_3p (mature (guide))
  11. Gallus gallus gga-miR-133b
  12. Gekko japonicus Gja-Mir-133-P2-v2_3p (mature (guide))
  13. Homo sapiens Hsa-Mir-133-P2-v2_3p (mature (guide))
  14. Lepisosteus oculatus (spotted gar) Loc-Mir-133-P2-v2_3p (mature (guide))
  15. Macaca mulatta Mml-Mir-133-P2-v2_3p (mature (guide))
  16. Microcaecilia unicolor Mun-Mir-133-P2-v2_3p (mature (guide))
  17. Monodelphis domestica Mdo-Mir-133-P2-v2_3p (mature (guide))
  18. Monopterus albus Mal-Mir-133-P2a-v2_3p (mature (guide))
  19. Mus musculus Mmu-Mir-133-P2-v2_3p (mature (guide))
  20. Ornithorhynchus anatinus Oan-Mir-133-P2-v2_3p (mature (guide))
  21. Oryctolagus cuniculus (rabbit) Ocu-Mir-133-P2-v2_3p (mature (guide))
  22. Python bivittatus Pbv-Mir-133-P2-v2_3p (mature (guide))
  23. Rattus norvegicus Rno-Mir-133-P2-v2_3p (mature (guide))
  24. Sarcophilus harrisii Sha-Mir-133-P2-v2_3p (mature (guide))
  25. Taeniopygia guttata Tgu-Mir-133-P2-v2_3p (mature (guide))
  26. Tetraodon nigroviridis (spotted green pufferfish) Tni-Mir-133-P2a-v2_3p (mature (guide))
  27. Xenopus laevis (African clawed frog) xla-miR-133b
  28. Xenopus tropicalis (tropical clawed frog) xtr-miR-133b