Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) gga-miR-133b URS00003EDD3D_9031

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

gga-mir-133b: Gga-mir-133b is a miRNA that has been found to be prominently involved in inositol phosphate metabolism and phosphatidylinositol signaling [PMC8241840]. In a study comparing LB and NOR strains, gga-mir-133b was one of the nine upregulated miRNAs that showed enrichment in their target genes [PMC8241840]. In another study comparing WB and NOR muscles, gga-mir-133b was found to be downregulated in WB muscles [PMC8555438]. The target genes of gga-mir-133b were predicted to include collagen coding genes [PMC8555438]. Gga-mir-133b is part of the gga-miR-133 family, which is the most abundant miRNA family in breast muscle libraries [PMC4519947]. However, the expression levels of gga-miR-133a and gga-mir-133b were relatively low compared to other myomiRs in skeletal muscle libraries [PMC3107184]. Gga-mir-133b has been found to target focal adhesion genes, while other miRNAs such as gga-miR-146b-3p and gga-miR-223 target adherens junction genes [PMC6815035]. Additionally, the expression level of gga-mir-133b has been shown to increase significantly in breast muscle after chicken sexual maturity, which is known to involve fat deposition [PMC8002044].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUGGUCCCCUUCAACCAGCUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 28 other species

  1. Alligator mississippiensis Ami-Mir-133-P2-v2_3p (mature (guide))
  2. Bos taurus Bta-Mir-133-P2-v2_3p (mature (guide))
  3. Brugia malayi (agent of lymphatic filariasis) bma-miR-133
  4. Canis lupus familiaris (dog) Cfa-Mir-133-P2-v2_3p (mature (guide))
  5. Cavia porcellus (domestic guinea pig) Cpo-Mir-133-P2-v2_3p (mature (guide))
  6. Chrysemys picta bellii (western painted turtle) Cpi-Mir-133-P2-v2_3p (mature (guide))
  7. Ciona savignyi (Pacific transparent sea squirt) csa-miR-133
  8. Columba livia Cli-Mir-133-P2-v2_3p (mature (guide))
  9. Danio rerio (zebrafish) Dre-Mir-133-P2a-v2_3p (mature (guide))
  10. Dasypus novemcinctus (nine-banded armadillo) Dno-Mir-133-P2-v2_3p (mature (guide))
  11. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-133-P2-v2_3p (mature (guide))
  12. Gekko japonicus Gja-Mir-133-P2-v2_3p (mature (guide))
  13. Homo sapiens Hsa-Mir-133-P2-v2_3p (mature (guide))
  14. Lepisosteus oculatus (spotted gar) Loc-Mir-133-P2-v2_3p (mature (guide))
  15. Macaca mulatta Mml-Mir-133-P2-v2_3p (mature (guide))
  16. Microcaecilia unicolor Mun-Mir-133-P2-v2_3p (mature (guide))
  17. Monodelphis domestica Mdo-Mir-133-P2-v2_3p (mature (guide))
  18. Monopterus albus Mal-Mir-133-P2a-v2_3p (mature (guide))
  19. Mus musculus Mmu-Mir-133-P2-v2_3p (mature (guide))
  20. Ornithorhynchus anatinus Oan-Mir-133-P2-v2_3p (mature (guide))
  21. Oryctolagus cuniculus (rabbit) Ocu-Mir-133-P2-v2_3p (mature (guide))
  22. Python bivittatus Pbv-Mir-133-P2-v2_3p (mature (guide))
  23. Rattus norvegicus Rno-Mir-133-P2-v2_3p (mature (guide))
  24. Sarcophilus harrisii Sha-Mir-133-P2-v2_3p (mature (guide))
  25. Taeniopygia guttata Tgu-Mir-133-P2-v2_3p (mature (guide))
  26. Tetraodon nigroviridis (spotted green pufferfish) Tni-Mir-133-P2a-v2_3p (mature (guide))
  27. Xenopus laevis (African clawed frog) xla-miR-133b
  28. Xenopus tropicalis (tropical clawed frog) xtr-miR-133b
Publications