Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Microcebus murinus (gray mouse lemur) mmr-let-7f URS00003B7674_30608

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAGGUAGUAGAUUGUAUAGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 60 other species

  1. Alligator mississippiensis (American alligator) Ami-Let-7-P2b1_5p (mature (guide))
  2. Anolis carolinensis aca-let-7f-5p
  3. Ateles geoffroyi (black-handed spider monkey) microRNA let-7f-1
  4. Bos taurus (cattle) bta-let-7f
  5. Callithrix jacchus (white-tufted-ear marmoset) cja-let-7f
  6. Callorhinchus milii Cmi-Let-7-P2a4_5p (mature (guide))
  7. Canis lupus familiaris (dog) cfa-let-7f
  8. Capra hircus (goat) chi-let-7f-5p
  9. Cavia porcellus cpo-let-7f-5p
  10. Chiloscyllium plagiosum microRNA cpl-let-7f
  11. Chrysemys picta bellii Cpi-Let-7-P2b1_5p (mature (guide))
  12. Chrysemys picta (Painted turtle) cpi-let-7f-5p
  13. Columba livia (rock pigeon) cli-let-7f-5p
  14. Cricetulus griseus cgr-let-7f
  15. Danio rerio (zebrafish) dre-let-7f
  16. Dasypus novemcinctus (nine-banded armadillo) dno-let-7f-5p
  17. Daubentonia madagascariensis (aye-aye) dma-let-7f
  18. Echinops telfairi Ete-Let-7-P2b1_5p (mature (guide))
  19. Eptatretus burgeri Ebu-Let-7-P2o11_5p (mature (guide))
  20. Equus caballus (horse) eca-let-7f
  21. Gadus morhua (Atlantic cod) gmo-let-7f-5p
  22. Gallus gallus (chicken) gga-let-7f-5p
  23. Gekko japonicus Gja-Let-7-P2b1_5p (mature (guide))
  24. Gorilla gorilla (western gorilla) microRNA let-7f-1
  25. Homo sapiens (human) hsa-let-7f-5p
  26. Ictalurus punctatus ipu-let-7f
  27. Lagothrix lagotricha microRNA let-7f-1
  28. Latimeria chalumnae Lch-Let-7-P2b1_5p (mature (guide))
  29. Lemur catta microRNA let-7f-1
  30. Lepisosteus oculatus (spotted gar) Loc-Let-7-P2b1_5p (mature (guide))
  31. Macaca mulatta mml-let-7f-5p
  32. Macaca nemestrina (pig-tailed macaque) microRNA let-7f-1
  33. Monodelphis domestica (gray short-tailed opossum) mdo-let-7f-5p
  34. Monopterus albus (swamp eel) Mal-Let-7-P2b1a_5p (mature (guide))
  35. Mus musculus mmu-let-7f-5p
  36. Nomascus leucogenys nle-let-7f
  37. Ophiophagus hannah (king cobra) oha-let-7f-5p
  38. Oreochromis niloticus oni-let-7f
  39. Ornithorhynchus anatinus (platypus) oan-let-7f-5p
  40. Oryctolagus cuniculus (rabbit) ocu-let-7f-5p
  41. Otolemur garnettii oga-let-7f
  42. Ovis aries miscellaneous RNA
  43. Pan paniscus ppa-let-7f
  44. Pan troglodytes ptr-let-7f
  45. Papio hamadryas (hamadryas baboon) pha-let-7f
  46. Pongo pygmaeus ppy-let-7f
  47. Pteropus alecto (black flying fox) pal-let-7f-5p
  48. Python bivittatus pbv-let-7f-5p
  49. Rattus norvegicus (Norway rat) rno-let-7f-5p
  50. Saguinus labiatus (red-chested mustached tamarin) microRNA let-7f-1
  51. Saimiri boliviensis boliviensis sbo-let-7f
  52. Sarcophilus harrisii Sha-Let-7-P2b1_5p (mature (guide))
  53. Sphenodon punctatus Spt-Let-7-P2b1_5p (mature (guide))
  54. Sus scrofa ssc-let-7f-5p
  55. Taeniopygia guttata tgu-let-7f-5p
  56. Tor tambroides (Thai mahseer) let-7f
  57. Tupaia chinensis tch-let-7f-5p
  58. Tursiops truncatus let-7f
  59. Xenopus laevis xla-let-7f-5p
  60. Xenopus tropicalis xtr-let-7f